View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_151 (Length: 234)
Name: NF6131_high_151
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_151 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 43482320 - 43482264
Alignment:
| Q |
1 |
atcatccttggagagagtgtgctggtctgaataagtaataataaaaactattagaaa |
57 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43482320 |
atcatcctttgagagagtgtgctggtctgaataagtaataataaaaactattagaaa |
43482264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 188 - 218
Target Start/End: Complemental strand, 43482136 - 43482106
Alignment:
| Q |
188 |
gctttatgagatgatatacatgctgttgatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43482136 |
gctttatgagatgatatacatgctgttgatt |
43482106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University