View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_154 (Length: 229)
Name: NF6131_high_154
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_154 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 209
Target Start/End: Original strand, 34275637 - 34275834
Alignment:
| Q |
11 |
agtgagaagaagaagaaagaaaatcgaggacacaactgatgtagcaacatatacaaaacaccatcctcttttctcatatcttggtaaaaaccnnnnnnnn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275637 |
agtgagaagaagaagaaagaaaatcgaggacacaactgatgtagcaacatatacaaaacaccatcctcttttctcatatcttggtaaaaaccttttttt- |
34275735 |
T |
|
| Q |
111 |
gcattcatttatctttatagcagcttatttgcatatcatttccttattgtttaccaatgcttgtccctactttagagaataagaaatctgatgctgatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34275736 |
gcattcatttatctttatagcagcttatttgcatatcatttccttattgtttaccaatgcttgtccctactttagagaataagaaatctgatgctgatg |
34275834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University