View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_156 (Length: 227)
Name: NF6131_high_156
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_156 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 14 - 211
Target Start/End: Original strand, 46080931 - 46081128
Alignment:
| Q |
14 |
atgaacaaaaacagacgagagaagagcaattaccggccagcaaagcatacatctaactattaactgtcccggcccagcccattagagagttgaacttgtt |
113 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46080931 |
atgagcaaaaacagatgagagaagagcaattaccggccaacaaagcatacatcaaactattaactgtcccggcccagcccattagacagttgaacttgtt |
46081030 |
T |
 |
| Q |
114 |
cggcactccctgcagcatagcatcataagtttgttcttcgttttcattctttcagcaaagctcgaagttgtcnnnnnnnccttcttggtagaatattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
46081031 |
cggcactccctgcagcatagcatcataagtttgttcttcgttttcattctttcagcaaagctcgaagttgtctttttttccttcttggtagaatattt |
46081128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University