View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_43 (Length: 399)
Name: NF6131_high_43
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 329
Target Start/End: Original strand, 35205511 - 35205822
Alignment:
| Q |
14 |
gaatatgaattgctaatgctaacgtgatccaagcattcttctacttactgatttttagtgtaccagctgagtaatcgccaattcatcttgaatctttgcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205511 |
gaatatgaattgctaatgctaacgtgatccaagcattcttctacttactgatttttagtgtaccagctgagtaatcgccaattcatcttgaatctttgcc |
35205610 |
T |
 |
| Q |
114 |
tttcttcaaatgcacaaccctacccacttcaagcatttagcctgcttgaataataacgcttttccttctagaatttgtgtcggtaccatatgccatgcac |
213 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35205611 |
tttcttcaagtgcaccaccctacccacttcaagcatttagcctgcttgaataataacgcttttccttctagaaattgtgtcggtaccatatgccatgcac |
35205710 |
T |
 |
| Q |
214 |
atttttacaagagttgtgcttacttgtacgtaccactaaatcagaccaacctttgcgacaatatatatatcattctctcttcaagtaacttatatgcatg |
313 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35205711 |
atttttacaagagttgtgcttac----atgtaccactaaatcagaccaacctttgtgacaacatatatatcattctctcttcaagtaacttatatgcatg |
35205806 |
T |
 |
| Q |
314 |
gaactcaaggccggtc |
329 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
35205807 |
gaactcaaggccggtc |
35205822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University