View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_61 (Length: 345)
Name: NF6131_high_61
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 11 - 330
Target Start/End: Complemental strand, 24722403 - 24722061
Alignment:
| Q |
11 |
caaagggaaaggaagagaaaccctaaaaactcacagactgacctggcggagttgttcttcttcatcaccattgctgacttgcatctttgattgatttgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24722403 |
caaagggaaaggaagagaaaccctaaaaactcacagactgacctggtggagttgttcttcttcatcaccactgctgacttgcatctttgattgatttgaa |
24722304 |
T |
 |
| Q |
111 |
aaaatcaatcgattaacagtgtgagtgattgaaaccaaacaaagaaccaacacgcgatttcatatttcttatagactcatatccgtattttccacaattt |
210 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||| |||||||||||| |||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24722303 |
aaaatcaatcgattaacagtctgagtgaatgaaaccaaaaaaagaaccaacatgcgatttcgtatttcttatcgactcatatccgtattttccacaattt |
24722204 |
T |
 |
| Q |
211 |
ctgtttattgacaaacctatccg--tatatattttttat---------------------attggtgttttccacaaattgttttttatgcaaagattta |
287 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24722203 |
ctgtttattgacaaacctatccgtatatattttttatattgcttgttgttaatataaaaaattggtgttttccacaaattgttttttatgcaaagattta |
24722104 |
T |
 |
| Q |
288 |
cttggtgcaatgattgtatagaaaacaaaattgagtctttttt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24722103 |
cttggtgcaatgattgtatagaaaacaaaattgagtctttttt |
24722061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University