View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_high_64 (Length: 339)
Name: NF6131_high_64
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_high_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 106 - 322
Target Start/End: Complemental strand, 34580646 - 34580428
Alignment:
| Q |
106 |
ttaaaagaataatcaaacatatgacatttttgtaaataatgtcaattaaatcatagatatacaggtggtgtttgtcaagtcaaattgatatcagaattgt |
205 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34580646 |
ttaaaaaaataatcaaatatatgacatttttgtaaataatgtcaattaaatcatagatatacaggtggtttttgtcaagtcaaattgatatcagaattgt |
34580547 |
T |
|
| Q |
206 |
ttttatttattctt--ggatagcagaaattgtttatcttgaggctgttgttttaagggtaaggaatatatccaatttatgtggagatggctattcagaat |
303 |
Q |
| |
|
|||| ||| || || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34580546 |
ttttttttttttttttggatagcagaaattgtttatcttgaggctgttgttttaagggtaaggaatatatccaatttatgtggagatggctattcagaat |
34580447 |
T |
|
| Q |
304 |
tgcatgtggaacggaacac |
322 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
34580446 |
tgcatgtggaacggaacac |
34580428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 7 - 95
Target Start/End: Complemental strand, 34580992 - 34580904
Alignment:
| Q |
7 |
tttgtattggggtgatttcgattgttatcaagactttgtgaaagaaagttggaatgatcttcaagtttcaagttggggtggtttgtttt |
95 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34580992 |
tttgtattgggatgatttcgattgttatcaagactttgtgaaagaaagttggaatgatcttcaagtttcaagttggggtggtttatttt |
34580904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University