View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6131_low_101 (Length: 275)

Name: NF6131_low_101
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6131_low_101
NF6131_low_101
[»] chr5 (1 HSPs)
chr5 (7-189)||(8078227-8078409)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 7 - 189
Target Start/End: Complemental strand, 8078409 - 8078227
Alignment:
7 ggagcagagactagtagagaaaaaagcaggagaaagtttatagaattgaccattatttctctttcaagatcacttcacagaacaaagtttattatgaaag 106  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8078409 ggagcaaagactagtagagaaaaaagcaggagaaagtttatagaattgaccattatttctctttcaagatcacttcacagaacaaagtttattatgaaag 8078310  T
107 aatagttaaagaggtgttttcaactgtattggatgaacaccatggtggaaatgatagtatttatagagaagaatcaatatagc 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
8078309 aatagttaaagaggtgttttcaactgtattggatgaacaccatggtggaaataatagtatttatagagaagaatcaatatagc 8078227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University