View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_105 (Length: 268)
Name: NF6131_low_105
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_105 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 261
Target Start/End: Original strand, 45460658 - 45460918
Alignment:
| Q |
1 |
cttttgatttgattaaattaaggatggttatatggaacttgtttaccattcagttagcatgattgtttgttaatgacattaaaatcataatagtgtaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460658 |
cttttgatttgattaaattaaggatggttatatggaacttgtttaccattcagttagcatgatcgtttgttaatgacattaaaatcataatagtgtaatt |
45460757 |
T |
|
| Q |
101 |
aattaagttcacaatttgtggcaggtttggctataatatgtggaatgcttgtgacaactagtctcatgtcactaatcattgctttgtattgggagaagaa |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45460758 |
aattaagttcacaatttgtggtaggtttggctataatatgtggaatgcttgtgacaactagtctcatgtcactaatcattgctttgtattgggagaagaa |
45460857 |
T |
|
| Q |
201 |
tttgatgatatccgcatgctttctgttatgttttggcctcgttgaggttgcatattcttcg |
261 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45460858 |
tttgatgatatctgcatgctttctgttatgttttggcctcgttgaggttgcatatttttcg |
45460918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University