View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_110 (Length: 259)
Name: NF6131_low_110
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_110 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 113 - 240
Target Start/End: Complemental strand, 39492040 - 39491920
Alignment:
| Q |
113 |
catgaaaatttcaaatgtctgcaaagttacgttttctatcaaaccttcgatgatcttcctgagctacaaacttattcaatatgaattcagatttcagaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39492040 |
catgaaaatttcaaatgtctgcaaagttgcgttttctatcaaaccttcgatgatcttcctgagctacaaacttattcaatatgaatt-------cagaat |
39491948 |
T |
 |
| Q |
213 |
caccctttacttcagaattggtgtcacc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39491947 |
caccctttacttcagaattggtgtcacc |
39491920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 14 - 75
Target Start/End: Complemental strand, 39492104 - 39492041
Alignment:
| Q |
14 |
ttattttttgagcgcaataataagttaaacaaac--atgcacgctagtattattcatagaaaat |
75 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39492104 |
ttattttttaagcgcaataataagttaaacaaacatatgcacgctagtattattcatagaaaat |
39492041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 110
Target Start/End: Original strand, 39287199 - 39287261
Alignment:
| Q |
48 |
atgcacgctagtattattcatagaaaataaaaatataaaatcatggggggacaataaccaaaa |
110 |
Q |
| |
|
||||||||||| |||||| || ||||| | |||||||||||||| |||| |||| |||||||| |
|
|
| T |
39287199 |
atgcacgctagcattattaatcgaaaagataaatataaaatcattggggcacaagaaccaaaa |
39287261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University