View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_114 (Length: 253)
Name: NF6131_low_114
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_114 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 40531500 - 40531258
Alignment:
| Q |
1 |
tgtaatcccttttgcctatgctttaaaatatcccctacaaaactgaaggtgtttgctaatcagaacatttttagcttggtattattgaagcaaaattgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40531500 |
tgtaatcccttttgcctatgctttaaaatatcccctacaaa-ctgaaggtttttgctaatcagaacatttttagcttggtattattgaagcaaaattgca |
40531402 |
T |
 |
| Q |
101 |
aggagaaagaggcgtagtgagtggatatgctggttgatccgttgcaagaaca-gatgcaattttatataggtacttgatatcagacgtataatttcgagc |
199 |
Q |
| |
|
||||||||||||||| |||||||||| ||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40531401 |
aggagaaagaggcgtggtgagtggatttgctgtttgatccgttgcaagaacatgatgcaattttatataggaacttgatatcagacgtataatttcgagc |
40531302 |
T |
 |
| Q |
200 |
atatcttatatagtttttaatttgatatttcttctttctctctg |
243 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40531301 |
atattttatatagtttttaatttgatatttgttctttctctctg |
40531258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University