View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_119 (Length: 251)
Name: NF6131_low_119
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_119 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 53090745 - 53090960
Alignment:
| Q |
18 |
agagagaagaatgagataattaggttagttataagtagtagttagtaatgtgtagtagaaatggacaatattaaaggagacaattggcataatatatggt |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53090745 |
agagagaagaatgagataattaggttggttataagtagtagttagtaatgtgtagtagaaatggacaatattaaaggagacaattggcataatatatggt |
53090844 |
T |
|
| Q |
118 |
atgaagattggaagcttcgtttcttcgcgtccactttactagaacaattctgttatactatctcagaaagagaaccaaagcggtgggtggatatgctatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53090845 |
atgaagattggaagcttcgtttcttcgcgtccacttcactagaacaattctgttatactatctcagaaagagagccaaagcggtgggtggatatgctatt |
53090944 |
T |
|
| Q |
218 |
ggtcttggatattgtt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
53090945 |
ggtcttggatattgtt |
53090960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University