View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_128 (Length: 247)
Name: NF6131_low_128
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_128 |
 |  |
|
| [»] scaffold0328 (2 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
| [»] scaffold0272 (5 HSPs) |
 |  |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |  |
|
| [»] scaffold0014 (4 HSPs) |
 |  |  |
|
| [»] scaffold0951 (2 HSPs) |
 |  |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (4 HSPs) |
 |  |  |
|
| [»] scaffold0227 (2 HSPs) |
 |  |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (4 HSPs) |
 |  |  |
|
| [»] scaffold0028 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0097 (2 HSPs) |
 |  |  |
|
| [»] scaffold0854 (1 HSPs) |
 |  |  |
|
| [»] scaffold0047 (2 HSPs) |
 |  |  |
|
| [»] scaffold0354 (1 HSPs) |
 |  |  |
|
| [»] scaffold2010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0279 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 218)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 3 - 134
Target Start/End: Original strand, 33338077 - 33338209
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcg |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33338077 |
tttccaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccattagtg |
33338176 |
T |
 |
| Q |
103 |
aggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
33338177 |
aggtgccacgtggccccctaaataatacacgtg |
33338209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 18995090 - 18994956
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18995090 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaacagcccccaatgttttgattttttggcagttttggacccccagtccattag |
18994991 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
18994990 |
tgaggtgccacgtggccccctaaataatacacgtg |
18994956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 56296643 - 56296777
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56296643 |
tctttccaaaagttgcggttatgtccccctaactaatttaaatacaaaacagccccctattttttgattttttggcagttttggacccccagtccattag |
56296742 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
56296743 |
tgaggtgccacgtggccccctaaataatacacgtg |
56296777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 18994693 - 18994826
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18994693 |
tctttcgaaaagttgcggttatgaccccctaactaatttaaatacaaaacagcccccaatgttttgattttttggcagttttggacccccagtccattag |
18994792 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgt |
133 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |
|
|
| T |
18994793 |
taaggtgccacgtggccccctaaataatacacgt |
18994826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 3770440 - 3770313
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3770440 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacagacccctatgttttgattgtttggcagttttggacccccagtccattagtgaggtg |
3770341 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
3770340 |
ccacgtggccccctaaataatacacgtg |
3770313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 46283028 - 46282897
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46283028 |
tctttctaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttgacagttttggacccccagtccattag |
46282929 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacac |
131 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| |
|
|
| T |
46282928 |
tgaggtgtcacgtggccccctaaataatacac |
46282897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 4902443 - 4902309
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4902443 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccccagtccattag |
4902344 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
4902343 |
tgaggtgccacgtggccccctaaataatacacgtg |
4902309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 9 - 134
Target Start/End: Original strand, 10045989 - 10046115
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgc |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
10045989 |
aaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagtttttgacccccagtccattagtgaggtgc |
10046088 |
T |
 |
| Q |
109 |
cacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||| ||||||||||||||||||||| |
|
|
| T |
10046089 |
cacgtggccccctaaataatacacgtg |
10046115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 43821985 - 43821851
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43821985 |
tctttccaaaagttgtggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattgtttggcagttttggacccctagtccattag |
43821886 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
43821885 |
tgaggtgccacgtggccccctaaataatacacgtg |
43821851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 1377631 - 1377766
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcc-tatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| || |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1377631 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcccccctatgttttgattctttggcagttttggacccccagtccatta |
1377730 |
T |
 |
| Q |
100 |
gcgaggtgccacgtg-ccccctaaataatacacgtg |
134 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
1377731 |
gtgaggtgccacgtgaccccctaaataatacacgtg |
1377766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 39332352 - 39332479
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39332352 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
39332451 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |
|
|
| T |
39332452 |
ccacgtggccccgtaaataatacacgtg |
39332479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 1377867 - 1377761
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1377867 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccattagcgaggtg |
1377768 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
1377767 |
ccacgtg |
1377761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 4902162 - 4902275
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4902162 |
tctttccaaaagttgctgttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
4902261 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4902262 |
tgaggtgccacgtg |
4902275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 10046216 - 10046110
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10046216 |
aaaagttgcggttatggccccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
10046117 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
10046116 |
ccacgtg |
10046110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 13021266 - 13021156
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
13021266 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccacagtccattag |
13021167 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
13021166 |
tgaggtgccac |
13021156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 19869445 - 19869311
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| ||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19869445 |
tctttccaaaagttgtggttatggtaccctaagtaatttaaatacaaaacaaccccctatgttttgattttttggcagttttggacccccagtccattag |
19869346 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| |
|
|
| T |
19869345 |
tgaggtgccatgtggccccctaaataatacacgtg |
19869311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 3770205 - 3770318
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3770205 |
tctttcttaaagttgcgattatggccccctaactaatttaaatacaaaacagacccctatgttttgattctttggcagttttggacccccagtccattag |
3770304 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3770305 |
tgaggtgccacgtg |
3770318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 56296878 - 56296772
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56296878 |
aaaagttgcggttatggtcccctaactaattttaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
56296779 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
56296778 |
ccacgtg |
56296772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 33338317 - 33338204
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||| ||| ||||||||| |
|
|
| T |
33338317 |
tctttctaaaagttgcggttctggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggactcccggtccattag |
33338218 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33338217 |
tgaggtgccacgtg |
33338204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 31560067 - 31560179
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||| | ||| |||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
31560067 |
tctttctaaaagttgcggttatgacctcctaactaatttaaatacaaaacagccccttatattttgattctctggcagttttggacccccagttcattag |
31560166 |
T |
 |
| Q |
101 |
cgaggtgccacgt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31560167 |
tgaggtgccacgt |
31560179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 104226 - 104323
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
104226 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
104323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 7396167 - 7396279
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| || ||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
7396167 |
tctttccaaaagttgcggttatg-ccccctaactaatttaaatacaaaacagccccccatgttttgattctttggcagttttggatccccaatccattag |
7396265 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7396266 |
tgaggtgccacgtg |
7396279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 19869203 - 19869316
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||| ||||| || || |||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
19869203 |
tctttccaaaagttacggttatgaccccctaactaatttaaatacaaatcaaccccctatgttttgattctttggcagttttggaaccccaatccattag |
19869302 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19869303 |
tgaggtgccacgtg |
19869316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 18994854 - 18994961
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcc-tatgttttgattttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| || |||||||||||| ||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
18994854 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagcccccctatgttttgattctttggcagttttgaacccccagtccatcagtgaggt |
18994953 |
T |
 |
| Q |
107 |
gccacgtg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
18994954 |
gccacgtg |
18994961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 30998209 - 30998304
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
30998209 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttggcagttttgaacccccagtcca |
30998304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 6768823 - 6768913
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6768823 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
6768913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 7644490 - 7644580
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7644490 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
7644580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7644746 - 7644656
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7644746 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
7644656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 13019306 - 13019411
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
13019306 |
aaaagttgtggttatggcccactaactaatttaaatacaaaacagcc-cctatgttttgattttttggcagttttggacccttagtccattagtgaggtg |
13019404 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
13019405 |
ccacgtg |
13019411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 41707751 - 41707841
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41707751 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
41707841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 110
Target Start/End: Original strand, 46282793 - 46282895
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |||||| |
|
|
| T |
46282793 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattcattggcagttttggacccccgctccattagtgaggtg |
46282892 |
T |
 |
| Q |
108 |
cca |
110 |
Q |
| |
|
||| |
|
|
| T |
46282893 |
cca |
46282895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 54216237 - 54216147
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54216237 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattttttggcagttttggacccccagtccatt |
54216147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 55586649 - 55586739
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
55586649 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
55586739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 6386757 - 6386854
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6386757 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
6386854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27751451 - 27751354
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27751451 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
27751354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 31209505 - 31209408
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
31209505 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccctagtccatt |
31209408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 35364482 - 35364385
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35364482 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacccccagtccatt |
35364385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 37289481 - 37289578
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37289481 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccagtccatt |
37289578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 37973539 - 37973636
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37973539 |
tctttctaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggacccccagtccatt |
37973636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 51696562 - 51696659
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51696562 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
51696659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 52046003 - 52045906
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52046003 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
52045906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 28981946 - 28982037
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28981946 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatta |
28982037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 48278203 - 48278108
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
48278203 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
48278108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 6387019 - 6386929
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
6387019 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
6386929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7666226 - 7666316
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| |||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7666226 |
tctttccaaaagttgcggttatgaacccctaaccaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
7666316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 17262123 - 17262213
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
17262123 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttagacccccagtccatt |
17262213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 20466418 - 20466508
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
20466418 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggatccccagtccatt |
20466508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 20466672 - 20466582
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20466672 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
20466582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 20472833 - 20472743
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20472833 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
20472743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 20473998 - 20473908
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20473998 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
20473908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 31209250 - 31209340
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31209250 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
31209340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 34158753 - 34158663
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34158753 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
34158663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 34957410 - 34957500
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34957410 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccccagtccatt |
34957500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35364222 - 35364312
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35364222 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
35364312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 38371544 - 38371454
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38371544 |
aaaaattgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
38371454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 52045747 - 52045837
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52045747 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggaccccca |
52045837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 7119620 - 7119717
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
7119620 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccactccatt |
7119717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 7705616 - 7705713
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7705616 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacccccagtccatt |
7705713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 8891680 - 8891777
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
8891680 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccaaagtccatt |
8891777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 18988467 - 18988370
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||| | ||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18988467 |
tctttttaaaagttgcggctatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
18988370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 26675079 - 26675176
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
26675079 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccaatccatt |
26675176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 27246885 - 27246974
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27246885 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccc |
27246974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27247146 - 27247049
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
27247146 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
27247049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 29548206 - 29548303
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
29548206 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccctcagtccatt |
29548303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 39136584 - 39136487
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||| ||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39136584 |
tctttccaaaagtagcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
39136487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 41205783 - 41205686
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41205783 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatattttgattctttggcagttttggacccccagtccatt |
41205686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 41787075 - 41787172
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||| ||||||||||| ||| |||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41787075 |
tctttcaaaaaattgcggttatggccctctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggacccccagtccatt |
41787172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 51537903 - 51537806
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
51537903 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagtcctctatgttttgattctttggcagttttggacccccaatccatt |
51537806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 52311089 - 52310992
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52311089 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaacccctatgttttgattctttggcagttttggacccccagtccatt |
52310992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 104487 - 104399
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
104487 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
104399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 51696816 - 51696728
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
51696816 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgacagttttggacccc |
51696728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 52114421 - 52114333
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
52114421 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
52114333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 54556902 - 54556814
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
54556902 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccc |
54556814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 31250749 - 31250666
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31250749 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
31250666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 37289736 - 37289653
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37289736 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
37289653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 47854265 - 47854170
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| ||||||||||| || ||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
47854265 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcccccgatgttttgattctttggcagttttggacccctagtccatt |
47854170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 232971 - 232882
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
232971 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttgacagttttggacccccagtccatt |
232882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 5344303 - 5344393
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5344303 |
aaaagttgcggttatagacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
5344393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 5344558 - 5344468
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||| || ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5344558 |
tctttccaaaagttgcggttatggacccctaactaatttgaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
5344468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 21536906 - 21536996
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21536906 |
tctttccaaaagttgcggttatggaaccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
21536996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 24415361 - 24415271
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
24415361 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccca |
24415271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 26675343 - 26675253
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26675343 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
26675253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 35083861 - 35083771
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35083861 |
aaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggacccccagtccatt |
35083771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39946106 - 39946196
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
39946106 |
tctttctaaaagttgcggttatggacccccaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggaccccca |
39946196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 45289780 - 45289690
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
45289780 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccaagtccatt |
45289690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 52310827 - 52310917
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52310827 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacggccccctatgttttgattctttggcagttttggaccccca |
52310917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 7666485 - 7666388
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| ||| |||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
7666485 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctttgttttgattctttggcagttttggacccccagaccatt |
7666388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11529785 - 11529882
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
11529785 |
tctttccaaaagttgcggttatggaccccttactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccctagtccatt |
11529882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 20472575 - 20472672
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| |||||| |||| |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
20472575 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaatagccccctatgttttgattctttggcatttttggacccccagtccatt |
20472672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 24415099 - 24415196
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
24415099 |
tctttccaaaagttgcagttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccagtccatt |
24415196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 39332585 - 39332474
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||||| |||||||| || |||||||||| ||| ||||||||||||||| || ||||||||||| |
|
|
| T |
39332585 |
tctttttaaaagttgcggttatggcccc-taactaatttaaatacaaaacaaccccctatgttttaattctttggcagttttgga-cctcagtccattag |
39332488 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39332487 |
tgaggtgccacgtg |
39332474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42672094 - 42672191
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
42672094 |
tctttcaaaaagttgcggttatagatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagcccatt |
42672191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 43821745 - 43821856
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| |||||||| || |||||||||| ||| ||||||||||||||| |||||||||||||| |
|
|
| T |
43821745 |
tctttccaaaagttgcggttatggccca-taactaatttaaatacaaaacaaccccctatgtttttattctttggcagttttgga-ccccagtccattag |
43821842 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43821843 |
tgaggtgccacgtg |
43821856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 17262372 - 17262284
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
17262372 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggacccc |
17262284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 29432327 - 29432239
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
29432327 |
aaaagttacggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
29432239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 7119874 - 7119791
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7119874 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggaccccca |
7119791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 8891933 - 8891850
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
8891933 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttagcagttttggaccccca |
8891850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 17554326 - 17554243
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17554326 |
aaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
17554243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 18988212 - 18988295
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18988212 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
18988295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 7 - 114
Target Start/End: Original strand, 23769836 - 23769942
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
||||||||| ||||||| |||||||| ||||||| | ||||||||||| | |||||||||||| |||||||||||| || |||||||||||||| ||||| |
|
|
| T |
23769836 |
taaaagttgtggttatggccccctaattaatttacatacaaaacagccccttatgttttgattctttggcagttttaga-ccccagtccattagtgaggt |
23769934 |
T |
 |
| Q |
107 |
gccacgtg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
23769935 |
gccacgtg |
23769942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 24542787 - 24542870
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24542787 |
aaaagttacggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
24542870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 28982192 - 28982109
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28982192 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
28982109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 34363098 - 34363015
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
34363098 |
aaaagttgcggttatgggcccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggcccccca |
34363015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 45289533 - 45289616
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45289533 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
45289616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 51537456 - 51537543
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
51537456 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagtttttgaccc |
51537543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 3 - 98
Target Start/End: Original strand, 54556642 - 54556737
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
54556642 |
tttccaaaagttgcggttatggacctctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccaatccatt |
54556737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 4107538 - 4107628
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| | |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
4107538 |
aaaagttacagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
4107628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 23315665 - 23315579
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
23315665 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacc |
23315579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 29548467 - 29548377
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29548467 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
29548377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 34158497 - 34158587
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
34158497 |
tctttccaaaaattgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggaccccca |
34158587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 37973802 - 37973712
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| | |||||| || |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
37973802 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatataaaacaaccccctatgttttgattctttgacagttttggaccccca |
37973712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 39136331 - 39136413
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
39136331 |
aaaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccc |
39136413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 40350869 - 40350959
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
40350869 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttgaacccctagtccatt |
40350959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 41205524 - 41205614
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
41205524 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaaaagccccctatgttttgattctttgacagttttggaccccca |
41205614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 42672355 - 42672269
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
42672355 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggacc |
42672269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 9 - 91
Target Start/End: Original strand, 54215990 - 54216072
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
54215990 |
aaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
54216072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 54606920 - 54607010
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54606920 |
aaaagttgcggttatagactcctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacccccagtccatt |
54607010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 17554071 - 17554168
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| ||| ||| ||||||||||||||| |||| |
|
|
| T |
17554071 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagccacctatgttttgattcttttgcaattttggacccccagttcatt |
17554168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 39946364 - 39946268
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
39946364 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttgga-ccccagtccatt |
39946268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 14578720 - 14578632
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
14578720 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccctagtcca |
14578632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 17221582 - 17221498
Alignment:
| Q |
8 |
aaaagttgcggttatg-accccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17221582 |
aaaagttgcggttatggaccccctaactaatttaaatacaaaacagtcatctatgttttgattctttggcagttttggaccccca |
17221498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 21537139 - 21537067
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
21537139 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccagtccatt |
21537067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 34362853 - 34362941
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| || | |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
34362853 |
aaaagttgcggttatggacccctaactaatttaaatacaaaagagtcccctatgttttgattctttggcagttttgaacccccagtcca |
34362941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 7 - 87
Target Start/End: Complemental strand, 40351118 - 40351038
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
40351118 |
taaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacc |
40351038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 6769076 - 6768985
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
6769076 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttaccagttttggacccccattccatta |
6768985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 11530040 - 11529957
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
11530040 |
aaaagttgcggttatggacccctaactagtttaaatacaaaacagccccctatattttgattctttggcagttttggaccccca |
11529957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 20473763 - 20473834
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
20473763 |
ccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggatccccagtccatt |
20473834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 26171274 - 26171357
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26171274 |
aaaagttgcagttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccca |
26171357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 31844074 - 31843983
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatg-accccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| ||||||||| ||||||||||||| |||||||||||| || | |||||||||||||||| |
|
|
| T |
31844074 |
tctttccaaaagttgcggttatggaccccctaattaatttaaatacaaaacagcctcatatgttttgattcttggacagttttggaccccca |
31843983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 38371304 - 38371387
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38371304 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacatccccctatgttttgattctttggcagttttggaccccca |
38371387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 11159707 - 11159625
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||| |
|
|
| T |
11159707 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttg |
11159625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 14578464 - 14578554
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
14578464 |
tctttccaaaagttgcggttatgtacccctaactaatttaaatacaaaacagccctatatgttttgattctttggcagttttggcccccca |
14578554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 30998471 - 30998381
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
30998471 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacataacagccccctatgttttgattctttggcagttttggcccccca |
30998381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 31843820 - 31843910
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
31843820 |
aaaagttgtggttatggactcctaactaatttaaatacaaaacagacccctatgttttgattctttggcagttttggacccccagcccatt |
31843910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 34957644 - 34957554
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
34957644 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccttatgttttgattctttggtagttttggaccccca |
34957554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 91
Target Start/End: Original strand, 35083614 - 35083696
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
35083614 |
aaagttggggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
35083696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 52114168 - 52114258
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
52114168 |
aaaagatgcggttatagacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccctagtccatt |
52114258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 55586896 - 55586814
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
55586896 |
aaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttagcagttttggaccccca |
55586814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 41788344 - 41788263
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
41788344 |
aaaagttgcggttatggccctctaactaatttaaatacaaaacattcccctatgttttgattctttggcagttttggacccc |
41788263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 44921640 - 44921733
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
44921640 |
tctttttaaaagttgcggttatggatccctaactaatttaaatacaaaacaaccccctatgttttgattctttgacagttttggatccccagtc |
44921733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 47854009 - 47854090
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||| |
|
|
| T |
47854009 |
aaaagttgcggttatggacacctaactaatttaaatacaaaacagccccctatgttttgattctttggcatttttggacccc |
47854090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 51537718 - 51537622
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| |||||||| || ||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
51537718 |
tctttccaaaagttgcggttatggaccc-taactaatttaaatacaaaacatccctctatgttttgattctttggcagttttggacccccaatccatt |
51537622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 7705876 - 7705788
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||| |||||| |
|
|
| T |
7705876 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttaacagttttagacccc |
7705788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 94
Target Start/End: Original strand, 17221353 - 17221421
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
17221353 |
cccctaactaatttaaatacaaaacagccccctatgttttaattctttggcagttttggacccccagtc |
17221421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 22160115 - 22160027
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||| |||||||||| || ||||||||||| |
|
|
| T |
22160115 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttctgattttttgccaattttggacccc |
22160027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 8482892 - 8482975
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||| ||||||||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
8482892 |
aaaagttgcggttatggaccccaaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggcccccca |
8482975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 22159862 - 22159945
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
22159862 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
22159945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 28158929 - 28159012
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||| || |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
28158929 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacaaccccctatgttttgactctttggcagttttggaccccca |
28159012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 16 - 91
Target Start/End: Original strand, 35835817 - 35835892
Alignment:
| Q |
16 |
cggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35835817 |
cggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
35835892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 12641106 - 12641016
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| |||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12641106 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacaacgccctatgttttgattctttagcagttttggaccccca |
12641016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 26171520 - 26171430
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||| | ||||||||| ||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
26171520 |
aaaagttacggttatggatccctaattaatttaaatataaaacagccccctatgttttgtttctttggcagttttggacccccagtccatt |
26171430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 89
Target Start/End: Original strand, 27751191 - 27751277
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| |||||||| ||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||| ||||||||||||||| |
|
|
| T |
27751191 |
tttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttagcagttttggacccc |
27751277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29432073 - 29432162
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||| |||||||| ||| ||||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
29432073 |
tctttccaaaaattgcggttgtgaacccctaactaatttaaatacaaaatagcc-cctatgttttgattctttggcagttttggcccccca |
29432162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 50513078 - 50513168
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| |||||||| || | |||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
50513078 |
aaaagttgcagttatggatccctaactaatttaaatacaaaacaaccccttatgttttgattctttggcagttttggaccccaagtccatt |
50513168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 8483140 - 8483055
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagt |
93 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||| ||||| ||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
8483140 |
aaaagttgcggttatagacccctaactaatttaaatacaaatcagccccctatgtattgattctttggcagttttgaacccccagt |
8483055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 13608208 - 13608111
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| | |||||||| || |||||||||||| ||| | |||||||||||| ||||||||| |
|
|
| T |
13608208 |
tctttttaaaagttgcggttatggaaccctaactaatttaaatataaaacagcttcttatgttttgattctttagtagttttggaccctcagtccatt |
13608111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 17266034 - 17265953
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| |||| ||||||| |
|
|
| T |
17266034 |
tctttctaaaagttgcggttatttacccctaactaatttaaatacaaaacagctccctatgttttgattctttgacagtttt |
17265953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 24543023 - 24542939
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagt |
93 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
24543023 |
aaaagttgcagttatggatccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttagacccccagt |
24542939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 31250504 - 31250601
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||| ||||||||| | ||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
31250504 |
tctttccaaaagttgcggttatggattcctaactaatttaaatacaaaacagacctctatgttttgattctttgacagttttggacccctagtccatt |
31250601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 44921890 - 44921809
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||| ||||||| ||||||||||| |
|
|
| T |
44921890 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatattttgattctttggcaattttggacccc |
44921809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 9 - 66
Target Start/End: Complemental strand, 47821602 - 47821545
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
47821602 |
aaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttg |
47821545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 54607158 - 54607078
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| |||||| |||| ||||||||||||| ||| |||||||||||||| |
|
|
| T |
54607158 |
aaaagttgcggttatgaacccttaactaatttaaatacaaaatagccctctatgttttgattctttagcagttttggaccc |
54607078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 23770054 - 23769983
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttt |
72 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
23770054 |
tctttccaaaagttgcggttatggccccataactaatttaaatacaaaacagccccctatgttttgaatttt |
23769983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 12640853 - 12640943
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || | |||||||||||| ||||| ||||| ||||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
12640853 |
aaaagttgcggttatggacctccaactaatttaaatacaaatcagccccctatgtttatattctttggcagttttggaccccgagtccatt |
12640943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 5 - 91
Target Start/End: Complemental strand, 28159311 - 28159225
Alignment:
| Q |
5 |
tctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||| |||||||| || |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
28159311 |
tctaaaagttgcggttaaggacccctaactaatttaaatacaaaacaaccctctatgttttgatcctttggcagttttgaaccccca |
28159225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 16 - 98
Target Start/End: Original strand, 38153685 - 38153766
Alignment:
| Q |
16 |
cggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||| |||||||||||||| | ||||||| |||||||| ||||||||||| |
|
|
| T |
38153685 |
cggttatggtcccctaactaatttaaatacaaaacagactcctatgttttga-tctttggcaattttggactcccagtccatt |
38153766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 50996061 - 50996151
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||| ||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50996061 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaagcagttccctatgttttgattttttagcagttttggaccccca |
50996151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 27 - 88
Target Start/End: Complemental strand, 41707977 - 41707916
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||| |
|
|
| T |
41707977 |
ccctaactaatttaaatacaaaacagccccctatgttttgattctttgtcagttttggaccc |
41707916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 50513322 - 50513241
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||| | ||||||||||||| |||| |||||||||||||| |
|
|
| T |
50513322 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagtcctctatgttttgattctttgacagttttggacccc |
50513241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 37432498 - 37432423
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
37432498 |
aaaagttgcggttattgatccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttg |
37432423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4107791 - 4107701
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| | ||||||| | || ||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
4107791 |
tctttttaaaagttgcggttatggatccctaactaatttaaatataaaacagtccccaatgttttgattctttggtagttttggatcccca |
4107701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 96
Target Start/End: Original strand, 11159463 - 11159533
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||| ||||| |||||| |
|
|
| T |
11159463 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttaaacccctagtcca |
11159533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 23315408 - 23315498
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||| || | |||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
23315408 |
tctttcaaaaaattacagttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttaacagttttggaccccca |
23315498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 232745 - 232810
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| | ||||||| | |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
232745 |
cccctaactaatttaaatataaaacagtcccctatgttttgattctttgacagttttggaccccca |
232810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 17265875 - 17265940
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
17265875 |
tctttctaaaagttgcggttatggattcctaactaatttaaatacaaaacagccccctatgttttg |
17265940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 29627894 - 29627830
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgtttt |
65 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||| |
|
|
| T |
29627894 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccgtatgtttt |
29627830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40489237 - 40489324
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
40489237 |
tctttctaaaagttgcgattttggccccctaactaattaaaatacaaaacagcc-cctatgtattggatctttggcagttttggccccc |
40489324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 7472472 - 7472389
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| ||| ||||||||| | ||||||| ||| | |||| ||||||||| |
|
|
| T |
7472472 |
tctttctaaaagttgcgattttgaccccctaactaattaaaatacaaaacagtcccctatgtattggatctttgacagttttgg |
7472389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 18962152 - 18962077
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||| || ||||||||||||||||| ||| ||||||||| | ||||||| |||| | ||||||||||||| |
|
|
| T |
18962152 |
aaaagttgcgattttgaccccctaactaattaaaatacaaaacagacccctatgtattgaatctttggcagttttg |
18962077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 26858370 - 26858453
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||| ||||||||||| || || ||||||||||||| ||| ||||||||||||||||||| |||| | ||| |||||||||| |
|
|
| T |
26858370 |
tctttttaaaagttgcgattttggtcccctaactaattaaaatacaaaacagcctcctatgtattgaatctttagcagttttgg |
26858453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 48277949 - 48278024
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||| | | ||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
48277949 |
aaaagttgtggttatggaccccaaactaatttaaatatataacagccccctatgttttgattctttggcagttttg |
48278024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 47821501 - 47821551
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
47821501 |
tctttcaaaaagttgcggttatggccccctaactaatttaaatacaaaaca |
47821551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 52
Target Start/End: Complemental strand, 1988240 - 1988191
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacag |
52 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
1988240 |
tttctaaaagttgcggttatgaacccataactaatttaaatacaaaacag |
1988191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 10308651 - 10308563
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || |||| ||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
10308651 |
tctttctaaaagttgcgattttggccccgtaactaattaaaatacaaaacaaccccctatgtattggatatttggcagttttggccccc |
10308563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 50996274 - 50996222
Alignment:
| Q |
46 |
aaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||| ||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
50996274 |
aaaacggccccctatgttttgattttttgacagttttggacccccaatccatt |
50996222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 39668898 - 39668949
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacag |
52 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||| | ||||||| |
|
|
| T |
39668898 |
tctttctaaaaattgcggttatgaacccctaactaatttaaatataaaacag |
39668949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 22589479 - 22589397
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||||| || | | |||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
22589479 |
tctttctaaaagttgcgatttttgctccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
22589397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 13306933 - 13306852
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || ||||| ||||||||||| ||| | ||||||||||| ||||| ||| | |||||||||||||| |||| |
|
|
| T |
13306933 |
aaaagttgcgattttgacctcctaactaattaaaatataaaacagcctcatatgtattggatctttggcagttttggccccc |
13306852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 19693044 - 19693138
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||| ||||| | ||||||||||||||||| ||||||||| | ||||||||| |||| | | |||||||||||||||| ||||| |
|
|
| T |
19693044 |
ctttccaaaagttgtggttacggacccctaactaatttaaatacaaaacagacccctatgtttggattctgtt--agttttggacccccagaccatt |
19693138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 19703629 - 19703723
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||| ||||| | ||||||||||||||||| ||||||||| | ||||||||| |||| | | |||||||||||||||| ||||| |
|
|
| T |
19703629 |
ctttccaaaagttgtggttacggacccctaactaatttaaatacaaaacagacccctatgtttggattctgtt--agttttggacccccagaccatt |
19703723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 19957004 - 19956927
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctc-ctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || |||||| |||||||||| ||| ||||||||||| | |||||| |||| | |||||||||||||| |
|
|
| T |
19957004 |
aaaagttgcgattttgaccctctaactaattaaaatacaaaacagcccctctatgtattgaatctttggcagttttgg |
19956927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 36413712 - 36413793
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||| |||||||||| ||| ||||||||||| ||||| | |||| | |||||||||||||| |||| |
|
|
| T |
36413712 |
aaaagttgcgattttggccctctaactaattaaaatacaaaacagccccctatttattgaatctttggcagttttggccccc |
36413793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 55732975 - 55732894
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||| ||||||||||| || || |||||||||||||| ||| ||||||||| | ||||||| ||| | |||||||||||| |
|
|
| T |
55732975 |
tctttttaaaagttgcgattttggccccctaactaattaaaatacaaaacagtcccctatgtattggatatttggcagtttt |
55732894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 83
Target Start/End: Complemental strand, 14816893 - 14816813
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
14816893 |
tttctagaagttgcgattttggacccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
14816813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 19938328 - 19938416
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| |||||||| || || || |||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
19938328 |
tctttttaaaagttacgattttggccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttggccccc |
19938416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 31760816 - 31760880
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| | ||||||||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
31760816 |
ccccctaactaattaaaatataaaacagcctcctatgtattggatctttggcagttttggccccc |
31760880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 89
Target Start/End: Original strand, 50073300 - 50073379
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||| || ||||||||||||||||| ||| |||||||||||| |||||| ||| | ||||||||||||| |||| |
|
|
| T |
50073300 |
aaagttgcgattttgaccccctaactaattaaaatacaaaacagcct-ctatgtattggatcattggcagttttggccccc |
50073379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 50073583 - 50073495
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||| || || || |||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
50073583 |
tctttttaaaagttgcgattttggtcctctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
50073495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 1186685 - 1186772
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| ||||||||||| || || |||||||||||||| ||| ||||||||||| ||||| | ||| | |||| ||||||||| |||| |
|
|
| T |
1186685 |
ctttttaaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatatattggatctttgacagttttggccccc |
1186772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 8143084 - 8143147
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
8143084 |
cccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
8143147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 13607943 - 13608029
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| | |||||| || |||| |||| ||| | |||||||||| ||||| |
|
|
| T |
13607943 |
tctttccaaaagttgcggttatggacccctaactaatttaaatataaaacaaccctctatatttt-attctctggcagttttcgaccc |
13608029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 14816810 - 14816747
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||| ||||||| ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
14816810 |
cccctaactaattaaaatacataacagccccctatgttttggatttttggtagttttggccccc |
14816747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 33166386 - 33166445
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||||| ||| ||||||| ||| |||||||||||||||| |
|
|
| T |
33166386 |
ccccctaactaattaaaatacaaaacggccccctatgtattggatttttggcagttttgg |
33166445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 33168079 - 33168012
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| ||||||| ||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
33168079 |
tgaccccctaactaattaaaatacaaaactgccccctatgtattggatctttggcagttttggccccc |
33168012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 39907346 - 39907283
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| |||||||||||| |||||| ||| | |||||||||||||| |||| |
|
|
| T |
39907346 |
cccctaactaattaaaatacaaaacagccttctatgtattggatctttggcagttttggccccc |
39907283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 51543040 - 51543099
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
51543040 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
51543099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 55732619 - 55732682
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
55732619 |
cccctaactaattaaaatacaaaacagccccctatgtattggatatttggcagttttggccccc |
55732682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 36945546 - 36945628
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt-tttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || | |||||||||||||| ||| ||||||||||| ||||||| || ||| |||| |||||||||| |||| |
|
|
| T |
36945546 |
aaaagttgcgatttttgccccctaactaattaaaatacaaaacagccccctatgtattggatctttttgcagttttggccccc |
36945628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 44271940 - 44271878
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||| |||| | ||| |||||||||| |||| |
|
|
| T |
44271940 |
ccctaactaattaaaatacaaaacagccccctatgtattgaatctttagcagttttggccccc |
44271878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 2016716 - 2016655
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| |||||||||| || || ||| ||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
2016716 |
tctttccaaaagttgcgattttggccctctacctaattaaaatacaaaacagcctcctatgt |
2016655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 7 - 84
Target Start/End: Complemental strand, 19938608 - 19938531
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||| |||||| || || |||||||||||| | ||| |||||||| |||||||||| ||| | |||||||||||||| |
|
|
| T |
19938608 |
taaatgttgcgattttggccccctaactaaataaaatacaaaacatcctcctatgtattggatctttggcagttttgg |
19938531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 21871295 - 21871238
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||| | |||| | ||||||||||||| |
|
|
| T |
21871295 |
cccctaattaattaaaatacaaaacagcctcctatatattgaatctttggcagttttg |
21871238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 83
Target Start/End: Complemental strand, 21927156 - 21927099
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||| | |||| | ||||||||||||| |
|
|
| T |
21927156 |
cccctaattaattaaaatacaaaacagcctcctatatattgaatctttggcagttttg |
21927099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 23777344 - 23777263
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||| |||||||||| ||| ||||||||||| | ||||| ||| | |||||||||||||| |||| |
|
|
| T |
23777344 |
aaaagttgcgattttggccctctaactaattaaaatacaaaacagccccttatgtattggatctttggcagttttggccccc |
23777263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 53061827 - 53061754
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||| |||||| || |||||||| ||| | ||||||||||||| |
|
|
| T |
53061827 |
aagttgcgattttgaccccctaactaattaaaatacaaaatagtttcctatgtattggatctttggcagttttg |
53061754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 1140569 - 1140505
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| ||||||||| ||| |||||| |||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
1140569 |
ccccttaactaattgaaatacaaaatagcctcctatgtattggatctttggcagttttggccccc |
1140505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 134
Target Start/End: Complemental strand, 23769981 - 23769937
Alignment:
| Q |
91 |
agtccattagcgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
23769981 |
agtccattagtgaggtgccacgtggcaccctaaataatacacgtg |
23769937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 40919274 - 40919350
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||| || || ||||||||||||||||| ||| ||||||||| | |||||| ||| | |||||||||||||| |
|
|
| T |
40919274 |
aaaagttacgattttgaccccctaactaattaaaatacaaaacagtccactatgtattggatctttggcagttttgg |
40919350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 128)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 10893915 - 10894049
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10893915 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccattag |
10894014 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
10894015 |
tgaggtgccacgtggccccctaaataatacacgtg |
10894049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 20080144 - 20080278
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20080144 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccatatgttttgattttttggcagttttggaccaccagtccattag |
20080243 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
20080244 |
tgaggtgccacgtggccccctaaataatacacgtg |
20080278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 9067712 - 9067585
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9067712 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacaaccctctatgttttgactttttggcagttttggacccccagtccattagtgaggtg |
9067613 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
9067612 |
ccacgtggccccctaaataatacacgtg |
9067585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 11746259 - 11746136
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11746259 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattttttggcagttttggacccccagtccattagtgaggtg |
11746160 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|||||| |||| |||||||||||| |
|
|
| T |
11746159 |
ccacgtggccctctaaataataca |
11746136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 1896924 - 1897058
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||||||||||||| |||||| |||| | |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1896924 |
tctttccaaaagttgcggttataacctcctaactaatttaaatacaaaatagccccatatgttttgattttttggtagttttggacccccagtccattag |
1897023 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
1897024 |
tgaggtgccacgtggccccctaaataatacacgtg |
1897058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 1897166 - 1897053
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
1897166 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccctgtccattag |
1897067 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1897066 |
tgaggtgccacgtg |
1897053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 10894157 - 10894044
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10894157 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccccagtccattag |
10894058 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10894057 |
tgaggtgccacgtg |
10894044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 3535059 - 3534932
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3535059 |
aaaagttgcggttatggccccctaactattttaaatacaaaacagacccctatgttttgattctttggcagttttggacccccagtccattagtgaggtt |
3534960 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| |||| |||||||||||||||| |
|
|
| T |
3534959 |
ccacgtggccctctaaataatacacgtg |
3534932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 15273259 - 15273132
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||| | ||||| |||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
15273259 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagtcccctatattttgattgtttggcagttttggacccacagtccattagtgaggtg |
15273160 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||| ||||||||||||||||| |
|
|
| T |
15273159 |
ccacgtggcctcctaaataatacacgtg |
15273132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 3534824 - 3534937
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3534824 |
tctttccaaaagttgcggttatggtcccctaactaatttaaatacaaaacagccccatatgttttgatttttttgcagttttggacccccagtccattag |
3534923 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3534924 |
tgaggtgccacgtg |
3534937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 20080386 - 20080273
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20080386 |
tctttgtaaaagttgcggttatggccccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagttcattag |
20080287 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
20080286 |
tgaggtgccacgtg |
20080273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 25749981 - 25750106
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
25749981 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccaatccattag |
25750080 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaata |
125 |
Q |
| |
|
|||| ||||||| |||||||||||| |
|
|
| T |
25750081 |
tgaggggccacgtggccccctaaata |
25750106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 1815263 - 1815166
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1815263 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
1815166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 3185259 - 3185371
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
3185259 |
tctttccaaaagttgaggttatgaccccctaactaatttaaatacaaaacagccccctatcttttgattttttggcagttttgga-ccccagttcattag |
3185357 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3185358 |
tgaggtgccacgtg |
3185371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 15273024 - 15273137
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||||||||||| ||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
15273024 |
tctttccaaaagttgcggttatggctccctaactaatttaaatacaaaacagccctctatgttttgattctttgacagttttggacccccagtccattag |
15273123 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15273124 |
tgaggtgccacgtg |
15273137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 26716658 - 26716562
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccat |
97 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26716658 |
tctttccaaaagttgcggttatggccccctaactaacttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccat |
26716562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 7391764 - 7391667
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7391764 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
7391667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 5606329 - 5606419
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5606329 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
5606419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 11322305 - 11322215
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11322305 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
11322215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 11746024 - 11746134
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||| ||||| |||||||| |
|
|
| T |
11746024 |
tctttccaaaagttgcggttatggtcccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaaccccaatccattag |
11746123 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
11746124 |
tgaggtgccac |
11746134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 30965979 - 30965889
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30965979 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggaccccca |
30965889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 34705663 - 34705569
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34705663 |
tctttctaaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtcc |
34705569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 6261407 - 6261504
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||| |||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261407 |
tctttccaaaagttgcggttatggacccctaactaatataaatacaaaactgccccctatgttttgattttttggcagttttggacccccagtccatt |
6261504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11614924 - 11615021
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
11614924 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggactctcagtccatt |
11615021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 14997035 - 14997132
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14997035 |
tctttccaaaagttgcggttatggacccctaactaatttaactacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
14997132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20630636 - 20630539
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
20630636 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttaactttttggcagttttggacccccagtccatt |
20630539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27771501 - 27771404
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
27771501 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggactcccagtccatt |
27771404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 23883375 - 23883287
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23883375 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
23883287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 9067485 - 9067590
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| ||| |||||||||| ||||| |
|
|
| T |
9067485 |
aaaagttgcggctatgacctcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgga-ccctagtccattagtgaggta |
9067583 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
9067584 |
ccacgtg |
9067590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 10977691 - 10977781
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10977691 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
10977781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 12256797 - 12256887
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12256797 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
12256887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 12257051 - 12256961
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12257051 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
12256961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 17966117 - 17966035
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17966117 |
aaagttgcggttatgaacccctaactaatttaaatacaaaaaagcctcctatgttttgattctttggcagttttggaccccca |
17966035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 29696881 - 29696971
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29696881 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
29696971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 3194723 - 3194626
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
3194723 |
tctttctaaaagttgcggttatggatctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggatccccagtccatt |
3194626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 13042434 - 13042531
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
13042434 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttgacagttttggacccccagtccatt |
13042531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 15711923 - 15711830
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15711923 |
tctttttaaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtc |
15711830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 16765067 - 16765164
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || || ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16765067 |
tctttccaaaagttgcggttatgcacccctaactaatttaaatacaaaacaaccccccatgttttgattctttggcagttttggacccccagtccatt |
16765164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 31741058 - 31740961
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
31741058 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggtagttttggacccctagtccatt |
31740961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 15150008 - 15149920
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15150008 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
15149920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 9703824 - 9703741
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9703824 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
9703741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 28563354 - 28563441
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||| |
|
|
| T |
28563354 |
ctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacccc |
28563441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 2565359 - 2565269
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2565359 |
aaaagttgcggttatggatccttaactaatttaaacacaaaacagccctctatgttttgattctttggcagttttggacccccagtccatt |
2565269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 11615186 - 11615096
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
11615186 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggaccccca |
11615096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20630378 - 20630468
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20630378 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggaccccca |
20630468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 22279778 - 22279688
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| ||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22279778 |
aaaaattgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
22279688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 23291282 - 23291372
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23291282 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
23291372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 23883122 - 23883212
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
23883122 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgggagttttggacccctagtccatt |
23883212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 28930497 - 28930587
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
28930497 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagcctcctatgttttgattctttgacagttttggacccccagttcatt |
28930587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 30818495 - 30818405
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
30818495 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggacccccggtccatt |
30818405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 13440163 - 13440075
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
13440163 |
tctttccaaaagttgcggttacggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
13440075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 5606577 - 5606494
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
5606577 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
5606494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 10977938 - 10977855
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10977938 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
10977855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 11446264 - 11446169
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
11446264 |
tctttctaaaaattgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttaaacccccagtcca |
11446169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 18683045 - 18683128
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18683045 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
18683128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 30818251 - 30818334
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30818251 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
30818334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 2100406 - 2100496
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
2100406 |
tctttccaaaagttgcggttatgaatccctaactaatttaaatacaaaacagtcccctatgttttgattctttggtagttttggaccccca |
2100496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 6261664 - 6261574
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
6261664 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttaattctttggcagttttggaccccca |
6261574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 7324688 - 7324778
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
7324688 |
aaaagttgcggttatagatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttagacccccagtccatt |
7324778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7391511 - 7391601
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
7391511 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggatcccca |
7391601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 11213470 - 11213384
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
11213470 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacc |
11213384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 11277659 - 11277749
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11277659 |
aaaagttgcggttatagatccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacccccagtccatt |
11277749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 11321934 - 11322016
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
11321934 |
taaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
11322016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 22279525 - 22279615
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| || |||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22279525 |
tctttccaaaagttgcggttatggacccctaactaatttaaatactaaacagcccgctatgttttgattctttggcagttttggaccccca |
22279615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 23291536 - 23291446
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||| | |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
23291536 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagctccttatgttttgattctttggcagttttggacctccagtccatt |
23291446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 31951488 - 31951398
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31951488 |
tctttccaaaagttgcggttatggacacctaactaatttaaatacaaaacagccccctatgttttcattctttggcagttttggaccccca |
31951398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 13439903 - 13440000
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
13439903 |
tctttccaaaagttgcgtttatggacccctaactaatttaaatacaaaacagccccctatcttttgattctttggcagctttggacccccagttcatt |
13440000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27223596 - 27223499
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
27223596 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccctaatccatt |
27223499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 28563607 - 28563510
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| |||||||||||| | ||||||||| |
|
|
| T |
28563607 |
tctttcaaaaagttgcggttatggacccctaactaatttaaatacaaaacagacccctatgttttgattctttagcagttttggactctcagtccatt |
28563510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 31951231 - 31951328
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
31951231 |
tctttttaaaagttgcggttatggacccccaactaatttaaatacaaaacagccctctatgttttgattatttggcagttttggacctccagtacatt |
31951328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 1815009 - 1815092
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
1815009 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgtttcgattctttggcagttttggaccccca |
1815092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 2565111 - 2565194
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2565111 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
2565194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 10255554 - 10255637
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
10255554 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccca |
10255637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 11322055 - 11322138
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
11322055 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttgaaccccca |
11322138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 11446009 - 11446092
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
11446009 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggcccccca |
11446092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 14997289 - 14997206
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14997289 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
14997206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 15149760 - 15149843
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
15149760 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggcccccca |
15149843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 18683295 - 18683200
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||| ||||||| ||||||||| |||||||| || | |||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
18683295 |
tttccaaaagttgcggttatggacccctaattaatttaaatacaaaacaaccccatatgttttgattctttggtagttttggacccccagtccatt |
18683200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 2100661 - 2100572
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||| | || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2100661 |
aaaagttgtggttatggacccctaactaatttaaatacaaaaaaccc-cctatgttttgattctttggcagttttggacccccagtccatt |
2100572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 3195992 - 3195903
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||| | ||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3195992 |
aaaagttgtggttatggacccttaactaatttaaatataaaacagcc-cctatgttttgattctttggcagttttggacccccagtccatt |
3195903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13042695 - 13042605
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| |||||| |||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
13042695 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaatagccccttatgttttgattctttggcagttttggaccccca |
13042605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 17965872 - 17965962
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
17965872 |
aaaagttggggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttcgaccccaagtccatt |
17965962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 98
Target Start/End: Complemental strand, 21009006 - 21008936
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21009006 |
cctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
21008936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 30965724 - 30965814
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| | || ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30965724 |
aaaagttgcagttatggacccctaactaatttaaatacaaaacagccccttaagttttgattctttagcagttttggacccccagtccatt |
30965814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 31833553 - 31833464
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
31833553 |
tctttccaaaaattgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggtccccca |
31833464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10255807 - 10255710
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||| ||||| ||| ||||||||||||| ||||||||| | ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10255807 |
tctttttaaaagttgcagttatagacccataactaatttaaatacaaaacagtcctctatgttttgattctttggcagttttggacccccagtccatt |
10255710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 11277897 - 11277816
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
11277897 |
aaaagttgcggttatgaacccttgactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggacccc |
11277816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 21008760 - 21008841
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| | ||||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
21008760 |
aaaagttgtggttatgaacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttagacccc |
21008841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 26171494 - 26171406
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||| ||||| ||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26171494 |
tctttccaaaacttgcgattatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
26171406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 31833299 - 31833387
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||||||||| | ||||||||||| ||| |||||||| | |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
31833299 |
aaaagttgcggttatgaactcctaactaattgaaatacaaaacaactccctatgttttgattctttggcagttttgaacccccagtcca |
31833387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 15711668 - 15711751
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
15711668 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatattttgattctttggtagttttggaccccca |
15711751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 28930744 - 28930661
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
28930744 |
aaaagttgcggttatcgacccttaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
28930661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 7324916 - 7324851
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7324916 |
cccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
7324851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 34705409 - 34705493
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccag |
92 |
Q |
| |
|
||||||||||||| || ||| ||| ||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34705409 |
aaaagttgcggttctggacccttaattaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccag |
34705493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 3195749 - 3195832
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| ||||||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3195749 |
aaaagttgcggttatggatccctaattaatttaaatacaaaacagtcctctatgttttgattctttggcagttttggaccccca |
3195832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 31740802 - 31740885
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| |||| || ||||||||||||| |
|
|
| T |
31740802 |
aaaagttgtggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttgacatttttggaccccca |
31740885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 16765317 - 16765235
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| ||||||| ||||||| ||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
16765317 |
aaagttgaggttatggacccctaattaatttaaatacaaaacagccctctatgttttgatactttggcagttttggaccccca |
16765235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 88
Target Start/End: Original strand, 26171263 - 26171321
Alignment:
| Q |
30 |
taactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
26171263 |
taactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccc |
26171321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 3185437 - 3185376
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatt |
69 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
3185437 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgatt |
3185376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 30239491 - 30239410
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
30239491 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagcccaatatgttttgattatttggcagtttt |
30239410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 16735850 - 16735762
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||||||||||| |||||||| | ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
16735850 |
tttccaaaagttgcggttatggacccttaactaatttaaatacaaaacaactcactatgctttgattctttggcagttttggaccccca |
16735762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 21003395 - 21003491
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||| ||||||||| | | ||||||| |||| |||| |||||||||||||||| ||||| |
|
|
| T |
21003395 |
ctttccaaaagttgcggttacggacccctaactaatttaaatacaaaacagacccttatgtttggattatttgttagttttggacccccagaccatt |
21003491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 33720047 - 33720118
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| |||||||| |||| |||||||| ||||||| |||||| |
|
|
| T |
33720047 |
ccctaactaatttaaatacaaaacagccccctatattttgattctttgacagttttgaacccccaatccatt |
33720118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 44 - 98
Target Start/End: Original strand, 9703612 - 9703666
Alignment:
| Q |
44 |
acaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9703612 |
acaaaacagccccctatcttttgattctttggcagttttggacccccagtccatt |
9703666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 23349787 - 23349874
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| || ||||||| ||||||||| ||| ||||||||| | ||||||| |||| | |||||||||||||| |||| |
|
|
| T |
23349787 |
tctttccaaaagttgcgattttgacccc-taactaattaaaatacaaaacaggcccctatgtattgaatctttggcagttttggccccc |
23349874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 89
Target Start/End: Complemental strand, 23585240 - 23585181
Alignment:
| Q |
30 |
taactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||||||||| | ||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
23585240 |
taactaatttaaatacaaaacagtcccctatatttggattctttggcagttttggacccc |
23585181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 29873094 - 29873157
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||||||||| |
|
|
| T |
29873094 |
cccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggacccc |
29873157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 26479219 - 26479269
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
26479219 |
tctttccaaaagttgcgattatggccccctaactaatttaaatacaaaaca |
26479269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 378526 - 378465
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| ||| |||||| || || |||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
378526 |
tctttccaaatgttgcgattttggccccctaactaattaaaatacaaaacagcctcctatgt |
378465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 4037071 - 4037152
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
4037071 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttggccccc |
4037152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 29697130 - 29697057
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttg |
74 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||| ||||||||| ||||||| ||| | |||||||||||| |||| |
|
|
| T |
29697130 |
tctttccaaaagttgcagttatggacccctaattaatttaaatacaaaactgccccttatgttttgattctttg |
29697057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 32591871 - 32591810
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||| ||| | ||||||||||||| |
|
|
| T |
32591871 |
tgaccccctaactaattaaaatacaaaacagcctccgatgtattggatctttggcagttttg |
32591810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 929226 - 929290
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
929226 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
929290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 33265112 - 33265200
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || || |||||||||| ||| ||||||||||| |||| || ||| | |||||||||||||| |||| |
|
|
| T |
33265112 |
tctttctaaaagttgcgattttggtcctctaactaattaaaatacaaaacagccccctacgtattggatctttggcagttttggccccc |
33265200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 2017223 - 2017286
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
2017223 |
cccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
2017286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 22517500 - 22517433
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
22517500 |
tgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttgacagttttggccccc |
22517433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 23350200 - 23350126
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||| || || | |||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
23350200 |
aaaagttgcgattttggcaccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
23350126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 28960254 - 28960343
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||| || || |||| ||||||||| ||| ||||||||||| ||||||| ||| | |||||||| ||||| |||||| |
|
|
| T |
28960254 |
tctttccaaaagttgcgattttggcccc-taactaattaaaatacaaaacagccccctatgtattggatctttggcagctttggcccccca |
28960343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 33274284 - 33274346
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
33274284 |
ccctaactaattaaaatacaaaacagcctcctatgtattggatctttgacagttttggccccc |
33274346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 9952202 - 9952142
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
||||| ||||||||||| || ||||||| ||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
9952202 |
tctttttaaaagttgcgattttgacccc-taactaattaaaatacaaaacagcctcatatgt |
9952142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 11109014 - 11108934
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| | || ||||||| ||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
11109014 |
aaaagttgtgattttgaccccttaactaattaaaatacaaaacagcc-cctatgtattggatctttggcagttttggccccc |
11108934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 24897409 - 24897320
Alignment:
| Q |
1 |
tctttctaaaagt-tgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||| |||| || || ||| |||||||||| ||| ||||||||||||| ||||| || |||||||||||||||| |||| |
|
|
| T |
24897409 |
tctttttaaaagtatgcgattttggccctctaactaattaaaatacaaaacagcctcttatgtattagatttttggcagttttggccccc |
24897320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 32591629 - 32591710
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||| ||||| ||| ||||||||||| |||||| ||| | |||||||||||||| |||| |
|
|
| T |
32591629 |
aaaagttgcgattttggccccctaattaattaaaatacaaaacagccctctatgtattggatctttggcagttttggccccc |
32591710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 2018461 - 2018397
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
2018461 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttgtcagttttggtcccc |
2018397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 2018521 - 2018457
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | ||||| ||| | |||||||||||||| |||| |
|
|
| T |
2018521 |
ccccctaactaattaaaatacaaaacagccccttatgtattggatctttggcagttttggccccc |
2018457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 4793780 - 4793716
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||| ||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
4793780 |
ccccctaactaattaaaatacataacagccccctatgtattggatctttggcagttttggccccc |
4793716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 24119525 - 24119601
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| |||||||| | ||||||| ||| | |||||||||||||| |
|
|
| T |
24119525 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacaacaccctatgtattggatctttggcagttttgg |
24119601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 24418519 - 24418595
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || ||| || ||||||||||||| ||||||||| ||||||||| ||| | |||| ||||||||| |
|
|
| T |
24418519 |
aaaagttgcgattttgatccaataactaatttaaatacaaaacagtctcctatgtattggatctttgacagttttgg |
24418595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 107; Significance: 9e-54; HSPs: 191)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 43585831 - 43585965
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43585831 |
tctttctaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattgtttggcagttttggacccccagtccattag |
43585930 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
43585931 |
tgaggtgccacgtggccccctaaataatacacgtg |
43585965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 32555790 - 32555923
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
32555790 |
tctttttaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggactcccagtccattag |
32555889 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgt |
133 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
32555890 |
tgaggtgccacgtggccccctaaataatacacgt |
32555923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 3728310 - 3728444
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
3728310 |
tctttccaaaagttgcggttatggtcccctaactaatttaaatacaaaacagccccctatattttgattatttggcagttttggacccccagtcaattag |
3728409 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
3728410 |
tgaggtgccacgtggccccctaaataatacacgtg |
3728444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 39022 - 39149
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
39022 |
aaaagttgcggttatggtcccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccaagtccattagtgaggtg |
39121 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
39122 |
ccacgtggccccctaaataatacacgtg |
39149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 5891767 - 5891634
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||| |||||||| || ||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
5891767 |
tctttccaaaagttgcggttatggcccc-taactaatttaaatacaaaacaaccccctatgttttgattttttgacagttttgaacccccagtccattag |
5891669 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
5891668 |
tgaggtgccacgtggccccctaaataatacacgtg |
5891634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 41032473 - 41032340
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||| | ||||||||||| ||||||||||| | |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41032473 |
tctttccaaaagttgcggttatggccccatgactaatttaaatacaaaacagccccttatgttttgattttttggcagttttgga-ccccagtccattag |
41032375 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
41032374 |
tgaggtgccacgtggccccctaaataatacacgtg |
41032340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 5891527 - 5891639
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5891527 |
tctttctaaaagttgcggttatgacccc-taactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
5891625 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
5891626 |
tgatgtgccacgtg |
5891639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 26036503 - 26036390
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26036503 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
26036404 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
26036403 |
tgaggtgtcacgtg |
26036390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 9560121 - 9559988
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||||||| ||| |||||||||||| || | ||||||||||| |
|
|
| T |
9560121 |
tctttctaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccatatgttttaattctttggcagtttt-gaatctcagtccattag |
9560023 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
9560022 |
tgaggtgccacgtggccccctaaataatacacgtg |
9559988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 9071994 - 9072107
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| | ||||||||| |
|
|
| T |
9071994 |
tctttccaaaagttgcggttatgtccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccctcggtccattag |
9072093 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9072094 |
tgaggtgccacgtg |
9072107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 16079465 - 16079352
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16079465 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattatttggcagttttggacccccagtccattag |
16079366 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
16079365 |
tgaggtgtcacgtg |
16079352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 28251424 - 28251537
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
28251424 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccctcagtccattag |
28251523 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28251524 |
tgaggtgccacgtg |
28251537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 26036268 - 26036395
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||| ||||||||||| |||||||||||||| ||||||| |||| |||||| |||||||||| |||||| |
|
|
| T |
26036268 |
aaaagttgtggttatggcctcctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttagacccctagtccattagtgaggtg |
26036367 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
26036368 |
ccacgtggccccctaaataatacacgtg |
26036395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 9072236 - 9072102
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||| | |||| |||||||| ||||||||||||||||| |||||||||| | |
|
|
| T |
9072236 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagacctctatcttttgattctttggcagttttggacctccagtccattcg |
9072137 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9072136 |
tggggtgccacgtggccccctaaataatacacgtg |
9072102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10029359 - 10029262
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10029359 |
tctttcgaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccatt |
10029262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 20465529 - 20465642
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
20465529 |
tctttccaaaagttgcagttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccctcagtccattag |
20465628 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
20465629 |
tgaggtgccacgtg |
20465642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 43586073 - 43585960
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||| ||| ||||||||| |
|
|
| T |
43586073 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacgcccggtccattag |
43585974 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43585973 |
tgaggtgccacgtg |
43585960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 9559887 - 9559993
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||| || |||||| |
|
|
| T |
9559887 |
aaaagttgcggttatggccctctaactaatataaatacaaaacagccttctatgttttgattctttggcagttttggacccccagtccataagtgaggtg |
9559986 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
9559987 |
ccacgtg |
9559993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 28251665 - 28251532
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
28251665 |
tctttccaaaagttgcggttatagccccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttgga-ccccagtccattag |
28251567 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||| | |||| ||| |||||||||||| |
|
|
| T |
28251566 |
ggaggtgccacatggccctctagataatacacgtg |
28251532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 27264135 - 27264232
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27264135 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccaatccatt |
27264232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 32556032 - 32555919
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||||||| ||||||||| | | |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32556032 |
tctttccaaaagttgcggttatggcctcctaactaatttaaatacaaaacagtcccttatgttttgattatttggcagttttggacccccagtccattag |
32555933 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
32555932 |
tgaggtgctacgtg |
32555919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42779193 - 42779283
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42779193 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggaccccca |
42779283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 12049404 - 12049307
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12049404 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
12049307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 14647722 - 14647819
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
14647722 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
14647819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 16521180 - 16521277
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
16521180 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccggtccatt |
16521277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 39528792 - 39528885
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39528792 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtc |
39528885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 42739874 - 42739777
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
42739874 |
tctttttaaaagttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatgttttgaatctttggcagttttggacccccagtccatt |
42739777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 19849828 - 19849733
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||| ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19849828 |
tttccaaaagttgcggtcatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
19849733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 25631366 - 25631271
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25631366 |
tttctaaaagttgcggttatggacccctaattaatttaaatacaaaacagccccatatgttttgattctttggcagttttggacccccagtccatt |
25631271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 31456141 - 31456058
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31456141 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggaccccca |
31456058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 1055404 - 1055494
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1055404 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
1055494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 3020874 - 3020784
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
3020874 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacctccagtccatt |
3020784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 8755046 - 8755136
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8755046 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgatgctttggcagttttggacccccagtccatt |
8755136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 13960714 - 13960804
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13960714 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggaccccca |
13960804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 20974689 - 20974599
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20974689 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
20974599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 34606650 - 34606560
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34606650 |
aaaagttgcggttatggacccctagctaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
34606560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 40687949 - 40687859
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40687949 |
aaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
40687859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 40767921 - 40768011
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
40767921 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtccatt |
40768011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40768175 - 40768085
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40768175 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
40768085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 223181 - 223084
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
223181 |
tctttccaaaagttgcggttatggacccctaaataatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccaagtccatt |
223084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 4096478 - 4096574
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
4096478 |
tctttctaaaagttgcgtttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgga-ccccagtccatt |
4096574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 4125731 - 4125634
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4125731 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatattttgattctttggcagttttggacccccagtccatt |
4125634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 5088359 - 5088262
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
5088359 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattttttggcagttttggaccctcaatccatt |
5088262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 21583349 - 21583442
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21583349 |
tctttccaaaagttgcggttatggaccactaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtc |
21583442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 26152079 - 26151982
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26152079 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaactccctatgttttgattctttggcagttttggacccccagtccatt |
26151982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 28394959 - 28395056
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
28394959 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattttttggccgttttggacccccaatccatt |
28395056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 28620065 - 28620162
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
28620065 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggacccccagtccatt |
28620162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 3 - 96
Target Start/End: Original strand, 28736468 - 28736561
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28736468 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacccccagtcca |
28736561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2546397 - 2546485
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
2546397 |
tctttccaaaagttacggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattttttgacagttttggacccc |
2546485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 7219784 - 7219696
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
7219784 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
7219696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 30894151 - 30894239
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
30894151 |
tctttccaaaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccc |
30894239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 8339992 - 8340075
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8339992 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
8340075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 8755293 - 8755210
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8755293 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggaccccca |
8755210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 15738107 - 15738190
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15738107 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggaccccca |
15738190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 29560063 - 29559972
Alignment:
| Q |
1 |
tctttctaaaagttgcggttat-gaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
29560063 |
tctttttaaaagttgcggttatagaccccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccca |
29559972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 99
Target Start/End: Original strand, 31455915 - 31456006
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
31455915 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctatagcagttttggacccccagtccatta |
31456006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35306736 - 35306824
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35306736 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagc--cctatgttttgattctttggcagttttggaccccca |
35306824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 1055655 - 1055565
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1055655 |
tctttctaaaagttgcggttatagacccctaactaatttaaatacaaaacagtctcctatgttttgattctttagcagttttggaccccca |
1055565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 2710366 - 2710456
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2710366 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaagcagccccctatgttttgattctttggcagttttggaccccca |
2710456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 2710617 - 2710527
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
2710617 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagctccctatgttttgattctttggcagtttttgacccccagtccatt |
2710527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 4125470 - 4125560
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
4125470 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
4125560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 7219531 - 7219621
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7219531 |
aaaagttgcggttatggacccttaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
7219621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7623547 - 7623637
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7623547 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
7623637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 12049145 - 12049235
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12049145 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
12049235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 13356836 - 13356746
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13356836 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggaccccca |
13356746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 13960970 - 13960880
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13960970 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
13960880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 15738353 - 15738263
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15738353 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
15738263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 23499999 - 23500085
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23499999 |
aaaagttgcggttatgaacctctaactaatttaaatacaaaacagcccgctatgttttgattctttggcagttttggacccccagtc |
23500085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 26323655 - 26323565
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26323655 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccctcagtccatt |
26323565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 29391301 - 29391211
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29391301 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
29391211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 29559807 - 29559897
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
29559807 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggatccccagtccatt |
29559897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 34169068 - 34168978
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
34169068 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagtagttttggacccccagtccatt |
34168978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 34734353 - 34734263
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
34734353 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacaattttggacccccagtccatt |
34734263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 40297691 - 40297781
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40297691 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
40297781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 40297953 - 40297863
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40297953 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttaattttttggcagttttggaccccca |
40297863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 3728551 - 3728439
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||||||||||||| |||||||| | ||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
3728551 |
tctttccaaaagttacggttatggccccctaactaatttaaatacaaaacaatcctctatgttttgattctttggcaattttggacccccagtccattag |
3728452 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
3728451 |
tga-gtgccacgtg |
3728439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 13765548 - 13765451
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
13765548 |
tctttcaaaaaattgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccctagtccatt |
13765451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 26151827 - 26151908
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26151827 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggacccc |
26151908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 29183422 - 29183325
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
29183422 |
tctttttaaaagttgcggttatggacacctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaaccccaagtccatt |
29183325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 35055803 - 35055900
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || ||||||||||||||||||| |||||||| |||| ||||||||| |
|
|
| T |
35055803 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattttttgacagttttgtacccacagtccatt |
35055900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42947427 - 42947524
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| | ||||||| | ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42947427 |
tctttctaaaagttgcggttatggacctctaactaatttaaatataaaacagtcctctatgttttgattctttggcagttttggacccccagtccatt |
42947524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 29391064 - 29391136
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29391064 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
29391136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 29401376 - 29401288
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
29401376 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccc |
29401288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 3020627 - 3020710
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3020627 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccca |
3020710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 13170167 - 13170084
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
13170167 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcaattttgg |
13170084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 13765292 - 13765375
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13765292 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
13765375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 95
Target Start/End: Original strand, 16666106 - 16666192
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | ||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16666106 |
aaaagttgcggttatggacccctaactaatttaaatataaaacagcc-cctatgttttgaatttttggcagttttggacccccagtcc |
16666192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 22773865 - 22773782
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
22773865 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggaccccca |
22773782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 28736720 - 28736637
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28736720 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
28736637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 40687699 - 40687782
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
40687699 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
40687782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 7623800 - 7623710
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||| |||||| |||| |||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
7623800 |
aaaagttgcggttatggacccctaaccaatttaaatacaaaatagccccctatgttttgattctttggcggttttggacccccagtccatt |
7623710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 11480062 - 11480152
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11480062 |
tctttccaaaagttgaggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggaccccca |
11480152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20974486 - 20974576
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
20974486 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttgagcagttttggaccccca |
20974576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 22052726 - 22052636
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
22052726 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggcccccca |
22052636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 27264392 - 27264302
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27264392 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
27264302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 30894396 - 30894306
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
30894396 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggactctcagtccatt |
30894306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 31172851 - 31172761
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
31172851 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
31172761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 34082381 - 34082292
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| | ||||||||| |||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
34082381 |
aaaagttgcggttatg-caccctaactagtttaaatacaaaacagccccctatgttttgattctttgtcagttttggacccccagtccatt |
34082292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 35678118 - 35678208
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
35678118 |
tctttccaaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagctttggaccccca |
35678208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 8986636 - 8986733
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||| || |||||| |
|
|
| T |
8986636 |
tctttccaaaagttacggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaaccctcaatccatt |
8986733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 13356583 - 13356680
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||| |||||| || ||||| |
|
|
| T |
13356583 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacacccccctatgttttgattctttggcagttttagaccccgagcccatt |
13356680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 22052465 - 22052562
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||| ||||||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
22052465 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctaagttttgattctttggcagttttgaaccctcagtccatt |
22052562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 23103949 - 23104042
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||| |||||||| || |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
23103949 |
tctttccaaaagttgcggttatggacccctaattaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaacccccagtc |
23104042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 23263432 - 23263343
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| || ||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
23263432 |
tctttccaacagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccc |
23263343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 33825626 - 33825723
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| | |||||| || ||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
33825626 |
tctttccaaaagttgcggttatggacccctaactaatttaaatataaaacaaccctctatgttttgattctttggcagttttggacgcccagtccatt |
33825723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 34734102 - 34734191
Alignment:
| Q |
3 |
tttctaaaagttgcggttatg-accccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| |||| ||||||||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34734102 |
tttccaaaaattgcggttatggatcccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
34734191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 92
Target Start/End: Original strand, 931880 - 931964
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccag |
92 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
931880 |
aaaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggccccccag |
931964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 19849578 - 19849666
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||| |||||| |
|
|
| T |
19849578 |
tctttcaaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttagacccc |
19849666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 23104192 - 23104104
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
23104192 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggcccccca |
23104104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 39529052 - 39528964
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
39529052 |
tctttccaaaagttgcggttatggattcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
39528964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 16329614 - 16329697
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
16329614 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttagcagttttggaccccca |
16329697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 16597074 - 16597156
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
16597074 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttagcag-tttggaccccca |
16597156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 34082132 - 34082215
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
34082132 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttgaaccccca |
34082215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 34606399 - 34606487
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34606399 |
tctttccaaaagttgcggtt--ggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
34606487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 38465995 - 38466102
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||| | | ||||| ||||||||| ||||||||||| |||||||||||||||||| |||||||| |||| || |||||||| |
|
|
| T |
38465995 |
tctttctaaaagttgcggttacggcttcctaattaatttaaatacaaaacagccctctatgttttgattttttgacagttttgaaccctcaatccattag |
38466094 |
T |
 |
| Q |
101 |
cgaggtgc |
108 |
Q |
| |
|
||||||| |
|
|
| T |
38466095 |
tgaggtgc |
38466102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 1050062 - 1050148
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
1050062 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttagacc |
1050148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 15526730 - 15526820
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||| || || |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
15526730 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaagcaaccccctatgttttgattctttggcagttttggatcccca |
15526820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 16329859 - 16329770
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
16329859 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgga-ccccagtccatt |
16329770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 16666860 - 16666770
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| |||||||| || || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16666860 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacaacccccaatgttttgattctttggcagttttggaccccca |
16666770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 21583610 - 21583520
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| ||||||||| | |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21583610 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacagtcccctatgttttgattatttggcaattttggaccccca |
21583520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29183159 - 29183249
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||| ||||||||||| |||||||||||||| |||| || ||||||||||||| |
|
|
| T |
29183159 |
tctttccaaaagttgcggttatggacccctaactaacttaaatacaaaacagccccctatgttttgattctttgacaattttggaccccca |
29183249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 29401123 - 29401213
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| | ||| ||||| ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29401123 |
aaaagttgcggttatggacccataactaatttaaataaaaatcagccccctatattttgattctttggcagttttggacccccagtccatt |
29401213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 35678370 - 35678284
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
35678370 |
tctttttaaaagttgcggttatggacctctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacc |
35678284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 4096731 - 4096650
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
4096731 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccc |
4096650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 14647968 - 14647887
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||||||| |
|
|
| T |
14647968 |
aaaagtcgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagctttggacccc |
14647887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 113
Target Start/End: Complemental strand, 21347712 - 21347608
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||| |||||||| | |||||||||||||||| ||||||||| | ||||| ||||||||||||| ||||||| || |||||||||||||| || ||| |
|
|
| T |
21347712 |
aaaagttacggttatggctccctaactaatttaaatacaaaacagtcccctatattttgattttttgacagttttaga-ccccagtccattagtgaagtg |
21347614 |
T |
 |
| Q |
108 |
ccacgt |
113 |
Q |
| |
|
|||||| |
|
|
| T |
21347613 |
ccacgt |
21347608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 22627263 - 22627182
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| |||||||| || ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
22627263 |
aaaatttgcggttctggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
22627182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 5 - 86
Target Start/End: Original strand, 31172594 - 31172675
Alignment:
| Q |
5 |
tctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
31172594 |
tctaaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggac |
31172675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 42739560 - 42739641
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
42739560 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccc |
42739641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 8340240 - 8340152
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||| |||||||| || |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
8340240 |
aaaagttgcgcttatggaccccaaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaacccccagtcca |
8340152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 10029100 - 10029187
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10029100 |
tctttccaaaagttgcggttatggaccactaactaatttaaatacaaaatagcc-cctatgttttgattctttggcagttttggacccc |
10029187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 34168813 - 34168901
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||| ||||||||| |||||||||||||| |||| |
|
|
| T |
34168813 |
tctttcaaaaagttgcggttatggacccataactaatttaaatacaaaacagccccctacgttttgattctttggcagttttggtcccc |
34168901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 7 - 114
Target Start/End: Complemental strand, 24396087 - 24395980
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||||||| | |||||| | |||||||||||||| ||| |||||||| ||||| ||||||||||| ||||| |
|
|
| T |
24396087 |
taaaagttgtggttatggtcccctaattaatttaaatataaaacatgcccctatgttttgattattttgcagttttagaccctcagtccattagtgaggt |
24395988 |
T |
 |
| Q |
107 |
gccacgtg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
24395987 |
gccacgtg |
24395980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 39249 - 39144
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||| ||||||| || ||||||||||||| ||| |||||| ||||| |||||||| || |||||||||||||||||||||||||| |||||| |
|
|
| T |
39249 |
aaaagttgcagttatgatcca-taactaatttaaatacacaacagctccctatattttgattccttagcagttttggacccccagtccattagtgaggtg |
39151 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
39150 |
ccacgtg |
39144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 96
Target Start/End: Complemental strand, 932110 - 932040
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
932110 |
cccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttgaacccccagtcca |
932040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 2546652 - 2546562
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||| || ||||| |
|
|
| T |
2546652 |
aaaagttgcagttatggatccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccctagcccatt |
2546562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 5088100 - 5088190
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| |||||||| || | |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5088100 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacaaccccttatgttttgattctttagcagttttggaccccca |
5088190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 22627011 - 22627097
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||| |||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
22627011 |
tctttccaaaagttgtagttaaggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacc |
22627097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 22773616 - 22773706
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| | |||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||| ||||||||||| ||||||||| |
|
|
| T |
22773616 |
aaaagttacagttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcggttttggaccctcagtccatt |
22773706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 23502415 - 23502325
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| ||||| ||||||||||||| ||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
23502415 |
tctttccaaaagttgctattatggacccctaactaattaaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
23502325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 28395220 - 28395130
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| | ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
28395220 |
tctttccaaaagttgcggttatggacccctaactaatttaaatgcaaaacagtcatctatgttttgattctttagcagttttggaccccca |
28395130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 33203971 - 33204053
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
||||||||||||||| || |||| ||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
33203971 |
aaaagttgcggttatagacctctaattaatttaaatacaaaacagccccttatgttttgattttttggcagttttggaccccc |
33204053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 33204219 - 33204129
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||| | | |||||||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
33204219 |
aaaagttacggttatggacccctaactaatttaaatacaaaacagtcccttatgttttgattatttggcagttttggacctccaatccatt |
33204129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 35306982 - 35306896
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||| | |||||||||||| ||||||||||||||| || ||||| |
|
|
| T |
35306982 |
aaaagttgcggttatggacccctaactaatttaaatgcaaaacagccccttatgttttgattctttggcagttttggatcctcagtc |
35306896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 41880324 - 41880234
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| || ||||||||||||| |
|
|
| T |
41880324 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttaacaattttggaccccca |
41880234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 16521418 - 16521353
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
16521418 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
16521353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 41032233 - 41032345
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||| |||||| | | ||| ||||||||||| |||||||||||||||| | | || |||||| |
|
|
| T |
41032233 |
tctttttaaaagttgcggttatagtcccctaactaatttaaatacaaaataac-tcccatgttttgattctttggcagttttggacacacggttcattag |
41032331 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41032332 |
tgaggtgccacgtg |
41032345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 42739638 - 42739703
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
42739638 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
42739703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 28388267 - 28388179
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||| ||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
28388267 |
tctttccaaaaattgaggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattatttggcagttttgaacccc |
28388179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 26 - 114
Target Start/End: Complemental strand, 35818463 - 35818376
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||||||| ||||||||||| |||||||||||||| |||| ||||||| ||||||| ||||||||| ||| ||||||||| |
|
|
| T |
35818463 |
cccctatctaatttaaatacaaaacagcc-cctatgttttgattctttgacagttttagacccccggtccattagtgagatgccacgtg |
35818376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 16597320 - 16597233
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
|||||||||||||||| | | ||||||||||||| |||||||| || |||||||||||||| ||||| |||||| |||||||||||| |
|
|
| T |
16597320 |
aaaagttgcggttatggactcataactaatttaaatacaaaacaaccccctatgttttgattctttggtagttttagacccccagtcc |
16597233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 22925917 - 22925834
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22925917 |
aaaagttgtggttatggacttctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
22925834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 23263178 - 23263260
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| |||| | ||||||||||||||||| |||||||| ||||||| |
|
|
| T |
23263178 |
aaaagttgcggttatggacccctaactaatttaaatacaaaa-agccccatatgttttgattttttgacagttttgaaccccca |
23263260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 25566665 - 25566728
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
25566665 |
cccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccc |
25566728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 25631119 - 25631202
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||| | | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
25631119 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagtcccttatgttttgattctttggtagttttggaccccca |
25631202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 28388007 - 28388090
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| |||| ||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
28388007 |
tctttccaaaagttgcgtgtatggacccctaactaatttaaatacaaaacagcaccctatgttttgattctttggcagttttgg |
28388090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 42779455 - 42779360
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||| ||| ||||||| ||||||||||||||||| | ||||||| | ||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
42779455 |
tctttccaaaaattgtggttatggacccctaactaatttaaatataaaacagtccactatgttttgattctttggcagttttgaacccccagtcca |
42779360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 3223571 - 3223506
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
3223571 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagacccctatgttttg |
3223506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 15526956 - 15526883
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttg |
74 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
15526956 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttg |
15526883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 26323401 - 26323490
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatg-ttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| | |||| |||||||| ||||||||||| ||||||| |
|
|
| T |
26323401 |
tctttccaaaagttggggttatggacccctaactaatttaaatacaaaacagccccttatgtttttgattctttggcagtttcggacccc |
26323490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 28703936 - 28703851
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||| | |||| | || |||||||||||||| ||||||| ||||||||| |
|
|
| T |
28703936 |
tctttccaaaagttgcggttatggcccc-taactaatttaaatataaaataaccccctatgttttgattctttggcaattttggacc |
28703851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 3738523 - 3738458
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
3738523 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttg |
3738458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 16859984 - 16860049
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
||||| ||||||||| ||||||| |||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
16859984 |
tctttttaaaagttgtggttatggccccctaactaatttaaatacaaaacagacccctatgttttg |
16860049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 41880093 - 41880157
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttga-ttttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| ||||||| || ||||||||||| |
|
|
| T |
41880093 |
cccctaactaatttaaatacaaaacagccccctatgttttgatttttttgccaattttggacccc |
41880157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 9 - 87
Target Start/End: Complemental strand, 8986890 - 8986811
Alignment:
| Q |
9 |
aaagttgcgg-ttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||| ||| ||||||||| |
|
|
| T |
8986890 |
aaagttgcgggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttagcaattttggacc |
8986811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 2 - 89
Target Start/End: Complemental strand, 15204317 - 15204230
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| ||| ||||||||| | | ||||| ||| | |||||||||||||| |||| |
|
|
| T |
15204317 |
ctttctaaaagttgcgattttgaccccctaactaattaaaatacaaaacagtcccttatgtattggatctttggcagttttggccccc |
15204230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 56 - 99
Target Start/End: Original strand, 28703803 - 28703846
Alignment:
| Q |
56 |
cctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28703803 |
cctatgttttgattctttggcagttttggacccccagtccatta |
28703846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 33825879 - 33825800
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||| ||||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
33825879 |
aaaagttgtggttatggatccataactaatttaaatacaaaacagccctctatgttttaattctttggcagttttggacc |
33825800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 38163694 - 38163615
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| ||||||||||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
38163694 |
aagttgcgattttggccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttggccccc |
38163615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 37333820 - 37333767
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
37333820 |
tctttctaaaagttgcggttttggtcccctaactaatttaaatacaaaacagcc |
37333767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 39049050 - 39049131
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || ||||||| ||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
39049050 |
aaaagttgcgattttgaccccttaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
39049131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 12610554 - 12610478
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||| | || ||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
12610554 |
aaaagttgtgattttgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
12610478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 3 - 51
Target Start/End: Complemental strand, 16860091 - 16860043
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
16860091 |
tttctaaaagttgcggttatggtcccctaactaatttaaatacaaaaca |
16860043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 26366032 - 26365965
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
26366032 |
tgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
26365965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 18266378 - 18266431
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
18266378 |
tctttccaaaggttgcggttatggacccctaactaatttaaatacaaaacagcc |
18266431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 41138587 - 41138668
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||| ||| ||||||||||| ||||| | ||| | |||||||||||| |
|
|
| T |
41138587 |
tctttctaaaagttgcgattttagccccctaactaattaaaatacaaaacagccccctatatattggatctttggcagtttt |
41138668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 3223469 - 3223512
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
3223469 |
aaaaattgcggttatggccccctaactaatttaaatacaaaaca |
3223512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 10332250 - 10332191
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
10332250 |
ccccctaactaattaaaatacaaaacagccccctatgtattgtatctttggcagttttgg |
10332191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 41140401 - 41140366
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaa |
36 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41140401 |
tctttctaaaagttgcggttatggccccctaactaa |
41140366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 80
Target Start/End: Complemental strand, 22471975 - 22471905
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtt |
80 |
Q |
| |
|
|||||||| || ||||||||||| ||||| ||| ||||||||||| ||||||| ||| | |||||||||| |
|
|
| T |
22471975 |
aagttgcgattttgaccccctaagtaattaaaatacaaaacagccccctatgtattggatctttggcagtt |
22471905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 4146140 - 4146221
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
4146140 |
aaaagttgcgattttggacccctaactaattaaaatacaaaacagccccctatgtattggatctttgacagttttggccccc |
4146221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 6815533 - 6815606
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||||||| || | ||||||||||||||| ||| |||||||| ||| |||||| ||| | ||||||||||| |
|
|
| T |
6815533 |
aaaagttgcgattttaaccccctaactaattaaaatacaaaacaaccttctatgtattggatctttggcagttt |
6815606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 10331989 - 10332070
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||| |||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
10331989 |
aaaagttgcgattttggccccaaaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
10332070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 26 - 83
Target Start/End: Original strand, 38162644 - 38162701
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
38162644 |
cccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
38162701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 43222978 - 43222917
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| |||| || ||||| || |||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
43222978 |
tctttccaaaaattacggttttggccccctaactaattaaaatacaaaacagccccctatgt |
43222917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 12610270 - 12610357
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||| || || |||| ||| ||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
12610270 |
tctttttaaaagttgcgattttgtcccc-taattaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
12610357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 84
Target Start/End: Original strand, 13106722 - 13106778
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||| ||| | |||||||||||||| |
|
|
| T |
13106722 |
cctaactaattaaaatacaaaacagcctcttatgtattggatctttggcagttttgg |
13106778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 14514971 - 14514883
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| || ||||| ||||||| ||| ||| | ||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
14514971 |
tctttccaaaagttgcaattttgacctcctaactgattaaaataaaaaacagccccctatgtattggatctttggcagttttggccccc |
14514883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 73
Target Start/End: Original strand, 23695560 - 23695624
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatttttt |
73 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||| | ||||||||| |||||||| || |||||| |
|
|
| T |
23695560 |
aaagttgcggttatggacccctaattaaattaaataaaaaacagccccctatgttctgttttttt |
23695624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 25693934 - 25694009
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || ||| |||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
25693934 |
aaaagttgcgattttggccctctaactaattaaaatacaaaacagcc-cctatgtattggatctttggcagttttgg |
25694009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 41083293 - 41083229
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
41083293 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttgacagttttggccccc |
41083229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 194)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 18798056 - 18798194
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| | | || |||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
18798056 |
tctttctaaaagttgcggttatgaccccctaactaatttaaatacaaaacagtcccaaatattttgattttttggcagttttggacccctagtccattag |
18798155 |
T |
 |
| Q |
101 |
cgaggtgccacgtgccccctaaataatacacgtgccccc |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18798156 |
tgaggtgccacgtgccccctaaataatacacgtggcccc |
18798194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 10356143 - 10356277
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || |||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
10356143 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgactttttggcagttttgaacccccagtccattag |
10356242 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
10356243 |
tgaggtgccacgtggccccctaaataatacacgtg |
10356277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 10986267 - 10986133
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10986267 |
tctttttaaaagttacggttatgatcccctaactaatttaaatacaaaacagccctctatgttttgattttttggcagttttgaacccccagtccattag |
10986168 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
10986167 |
tgaggtgccacgtggccccctaaataatacacgtg |
10986133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 11275445 - 11275319
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| |||||||| || |||||||||||||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
11275445 |
aaaagttgcggttatggccccctaactaaattaaatacaaaacaaccccctatgttttgattttttggtagttttggaccctcagtccattagtgaggtg |
11275346 |
T |
 |
| Q |
108 |
ccacgtgccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11275345 |
ccacgtgccccctaaataatacacgtg |
11275319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 43408250 - 43408384
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43408250 |
tctttccaaaagttgcggttatggtcacctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
43408349 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
43408350 |
tgaggtgccacgtggccccctaaataatacacgtg |
43408384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 40436263 - 40436140
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40436263 |
tctttccaaaagttgcgattatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccattag |
40436164 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaa |
123 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
40436163 |
tgaggtgccacgtggccccctaaa |
40436140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 10385495 - 10385629
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||| ||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10385495 |
tctttctaaaagttgcggttatggcctcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagtattggacccccagtccattag |
10385594 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
10385595 |
tgaggtgccacgtggccccttaaataacacacgtg |
10385629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 10385736 - 10385624
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10385736 |
tctttccaaaagttgcgattatgaccccctaactaatttaaatacaaa-cagccccctatgttttgattttttggcagttttggacccccagtccattag |
10385638 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
10385637 |
tgaggtgccacgtg |
10385624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 16705716 - 16705592
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| | | |||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
16705716 |
aaaagttgcggttatcgccccctaactaatttaaatacaaaactgtcccctatgttttgattttttggcagttttggatccccagtccattagtgaggtg |
16705617 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacac |
131 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
16705616 |
ccacgtggccccctaaataatacac |
16705592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 17679952 - 17679828
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||| | | |||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
17679952 |
aaaagttgcggttatcgccccctaactaatttaaatacaaaactgtcccctatgttttgattttttggcagttttggatccccagtccattagtgaggtg |
17679853 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacac |
131 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
17679852 |
ccacgtggccccctaaataatacac |
17679828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 19233606 - 19233473
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||| |||||| |||| |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
19233606 |
tctttccaaaagttgcggttatggccccataactaatttaaatacaaaatagccccctatgttttgattctttagcagttttggacccccagtccattag |
19233507 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |
|
|
| T |
19233506 |
tgaggtg-cacgtggccccctaaataatacacgtg |
19233473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 19233366 - 19233478
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
19233366 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggacccccaatccattag |
19233464 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19233465 |
tgaggtgccacgtg |
19233478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 3 - 114
Target Start/End: Original strand, 26872409 - 26872520
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcg |
102 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
26872409 |
tttccaaaagttgcggttacagccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttgaacccccagtccattagtg |
26872508 |
T |
 |
| Q |
103 |
aggtgccacgtg |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26872509 |
aggtgccacgtg |
26872520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 19778534 - 19778429
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||| || |
|
|
| T |
19778534 |
aaaagttgcggttatgacccc-taactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgagatg |
19778436 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
19778435 |
ccacgtg |
19778429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 43408484 - 43408379
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43408484 |
aaaagttgcggttatggcccc-taactaatttaaatacaaaacagccccctatattttgattttttggcagttttggacccccagtccattagtgaggtg |
43408386 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
43408385 |
ccacgtg |
43408379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 18798297 - 18798184
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
18798297 |
tctttccaaaagttgcggttatagccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttagacccccagttcattag |
18798198 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
18798197 |
tgaggggccacgtg |
18798184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 34288074 - 34288171
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34288074 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
34288171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 26872640 - 26872515
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||| | |||||||||||||| ||||||| ||||||| ||||||||| ||| |||||| |
|
|
| T |
26872640 |
aaaagttgcggttatgaccctctaactaatttaaatacaaaacagtcccctatgttttgattctttggcaattttgga--cccagtccaatagtgaggtg |
26872543 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
26872542 |
ccacgtggccccctaaataatacacgtg |
26872515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 3 - 114
Target Start/End: Complemental strand, 10356383 - 10356272
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcg |
102 |
Q |
| |
|
|||| |||||||||||||||| |||| |||||||||| || ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
10356383 |
tttccaaaagttgcggttatggccccttaactaatttgaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtg |
10356284 |
T |
 |
| Q |
103 |
aggtgccacgtg |
114 |
Q |
| |
|
| |||||||||| |
|
|
| T |
10356283 |
atgtgccacgtg |
10356272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 9035649 - 9035552
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9035649 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
9035552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10312514 - 10312417
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10312514 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
10312417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 35437232 - 35437329
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35437232 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
35437329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 19778307 - 19778434
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaaca-gcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| | |||||| |||| |||||||||||| ||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
19778307 |
aaaagttgcggttatggcctcctaactaatttaaatataaaacatgcctt-tatgttttgattctttggcagttttggacctccagtccattagtgaggt |
19778405 |
T |
 |
| Q |
107 |
gccacgtg-ccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||| |||||||||||||||||||| |
|
|
| T |
19778406 |
gccacgtgaccccctaaataatacacgtg |
19778434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 40436062 - 40436142
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40436062 |
tctttctaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttt |
40436142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 44189431 - 44189562
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
44189431 |
tctttccaaaagttgcggttatggcctcctaactaatttaaatacaaaacagccccctatgttttgattttttaacagttttgga-ccccagttcattag |
44189529 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacg |
132 |
Q |
| |
|
||||| ||||| ||||||||||||||||||| |
|
|
| T |
44189530 |
taaggtgtcacgtggccccctaaataatacacg |
44189562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 18295878 - 18295975
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18295878 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
18295975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 25983278 - 25983181
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
25983278 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgtacccccagtccatt |
25983181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 25987210 - 25987113
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
25987210 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccaagtccatt |
25987113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 30140946 - 30141043
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30140946 |
tctttccaaaagttgcggttatggacccctaactaatttaactacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
30141043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 39976755 - 39976852
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39976755 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
39976852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 18296138 - 18296050
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
18296138 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
18296050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 98
Target Start/End: Original strand, 7974417 - 7974512
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
7974417 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagttcatt |
7974512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 19194448 - 19194353
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
19194448 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
19194353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 35923918 - 35924013
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
35923918 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
35924013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 227983 - 228081
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
227983 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgccagttttggacccccaatccatta |
228081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 930741 - 930831
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
930741 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacctccagtccatt |
930831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 3925826 - 3925915
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3925826 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattttttgacagttttggacccccagtccatt |
3925915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 10986033 - 10986138
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
10986033 |
aaaagttgcggttatggctcc-taactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccaatccattagtgaggtg |
10986131 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
10986132 |
ccacgtg |
10986138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 11900337 - 11900247
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11900337 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
11900247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 20387830 - 20387740
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20387830 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
20387740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 20392304 - 20392214
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20392304 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
20392214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 21782629 - 21782719
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
21782629 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcatatgttttgattctttggcagttttggaccccca |
21782719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 27512835 - 27512925
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
27512835 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgacagttttggacccccagttcatt |
27512925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 37047946 - 37047856
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37047946 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccccagtccatt |
37047856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 7 - 89
Target Start/End: Complemental strand, 42751223 - 42751141
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
42751223 |
taaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgatttttttgcagttttggacccc |
42751141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 18074102 - 18074005
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
18074102 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccggtccatt |
18074005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 23740552 - 23740455
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
23740552 |
tctttcgaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggtagttttggacccccagtccatt |
23740455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 37047698 - 37047779
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37047698 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccc |
37047779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 46622840 - 46622743
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
46622840 |
tctttccaaaggttgcggttatggacccctaactaatttaaatacaaatcagccccctatgttttgattctttggcagttttggacccccagtccatt |
46622743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 34533240 - 34533328
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
34533240 |
tctttccaaaagttgtggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
34533328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 38882658 - 38882570
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38882658 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatattttgattctttggcagttttggaccccca |
38882570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 42997082 - 42997170
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
42997082 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttggcagttttagacccc |
42997170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 930988 - 930905
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
930988 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
930905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 7 - 98
Target Start/End: Complemental strand, 30757505 - 30757415
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30757505 |
taaaagttgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttgacagttttggacccccagtccatt |
30757415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 37452329 - 37452246
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37452329 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
37452246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 38882403 - 38882482
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
38882403 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacc |
38882482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7974678 - 7974588
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
7974678 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
7974588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 11578088 - 11578178
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
11578088 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagtttcagacccccagtccatt |
11578178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 24236395 - 24236305
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24236395 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacaacaccctatgttttgattctttggcagttttggaccccca |
24236305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 25983015 - 25983105
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
25983015 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggaccccca |
25983105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 30757250 - 30757340
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
30757250 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
30757340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 34533493 - 34533403
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34533493 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccttatgttttgattctttggcagttttggacccccagtccatt |
34533403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 35437501 - 35437411
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
35437501 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaaccccca |
35437411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 38445686 - 38445596
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38445686 |
aaaagttgcggttatggacccctaactagtttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
38445596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 38879194 - 38879284
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
38879194 |
aaaagttgcggttatggacccctagctaatttaaatacaaaacagcctcctatgttttgattctttgacagttttggacccccagcccatt |
38879284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 497399 - 497302
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||| ||| | ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
497399 |
tctttccaaaagttgcgtttacggacccctaactaatttaaatacaaaacagccccctatgttttgattatttgacagttttggacccccagtccatt |
497302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11900076 - 11900173
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
11900076 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttagcagttttggacccccaatccatt |
11900173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 18852780 - 18852683
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
18852780 |
tctttccaaaagttgaggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccaagtccatt |
18852683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 30028420 - 30028517
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| |||||| | || |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
30028420 |
tctttctaaaagttgcggttatggacctctaactaatttaaatacaaaataaccccctatgttttgattctttggcagttttggatccccagtccatt |
30028517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 37996298 - 37996201
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||| ||||| ||||||||| |
|
|
| T |
37996298 |
tctttccaaaagttgcggttatggacccctaactaatttaaatgcaaaacagcctcctatgttttgattctttggtagtttttgaccctcagtccatt |
37996201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 5096814 - 5096902
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
5096814 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
5096902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 18938990 - 18939062
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18938990 |
cccctaactaatttaaatacaaaacagccccctatgttttgattttttgacagttttggacccccagtccatt |
18939062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 24236140 - 24236236
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccat |
97 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||| | ||||||||||| | |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
24236140 |
tctttccaaaagttgcggttatggacccctaactaatttatatacaaaacagccccttatgttttgattctttggcagttttggatccccagtccat |
24236236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 26612368 - 26612460
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagt |
93 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||| |||| ||||||||| |
|
|
| T |
26612368 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagctttgaacccccagt |
26612460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 34404722 - 34404635
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
34404722 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggacccc |
34404635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 39753898 - 39753986
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
39753898 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
39753986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 47731735 - 47731823
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
47731735 |
aaaaattgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattatttggcagttttgaacccctagtcca |
47731823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 18852528 - 18852607
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
18852528 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacc |
18852607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 25036320 - 25036225
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||| ||||||||| |||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
25036320 |
tctttttaaaagttgtggttatgaacacctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccctagtcca |
25036225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 25986958 - 25987041
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||| |||||||||||||| |
|
|
| T |
25986958 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggctgttttggaccccca |
25987041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 35711938 - 35711847
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac-ccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||| |||||||||||| |
|
|
| T |
35711938 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccccagtccatt |
35711847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 36376086 - 36376177
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccag |
92 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
36376086 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttgaacccccag |
36376177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 47731983 - 47731900
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
47731983 |
aaaagttgcggttatggacccataactaatttaaatacaaaacagcctcctatgttttgattctttggcagttttggcccccca |
47731900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 3235403 - 3235313
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
3235403 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatattttgattctttggcagttttggaccccca |
3235313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 7195489 - 7195579
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
7195489 |
aaaagttgcagttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacctccagtccatt |
7195579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 11578343 - 11578253
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11578343 |
tctttccaaaggttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
11578253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 18073842 - 18073928
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
18073842 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggacc |
18073928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20387579 - 20387669
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
20387579 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttttgcagttttggaccccca |
20387669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20392053 - 20392143
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
20392053 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttttgcagttttggaccccca |
20392143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 34288338 - 34288248
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
34288338 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttgacagttttggaccccca |
34288248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 39754161 - 39754071
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
39754161 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
39754071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 42997332 - 42997242
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||| |||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42997332 |
aaaagttgcggttatagatccctaactaatttaaatacaaaacagccccctacgttttgattctttggcagttttggacccccagtccatt |
42997242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 44214685 - 44214775
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
44214685 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
44214775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 46622580 - 46622670
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||| |||| ||||||| ||||||||||||| |
|
|
| T |
46622580 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgtttggattctttggcaattttggaccccca |
46622670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 11275213 - 11275324
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||| ||| ||||||||||| |||||||||||||| ||||||||||||||||||| | |||||||| |
|
|
| T |
11275213 |
tctttccaaaagttgcggttatggcaccctaactaatataat-acaaaacagcc-cctatgttttgattctttggcagttttggacccctaatccattag |
11275310 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
11275311 |
tgaggtgtcacgtg |
11275324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 30699049 - 30699146
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||| || ||||||| |
|
|
| T |
30699049 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacctccggtccatt |
30699146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 34404469 - 34404566
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||| |||||| | || |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34404469 |
tctttccaaaaattgcggttatggacccctaactaatttaaatacaaaataaccccctatgttttgattatttagcagttttggacccccagtccatt |
34404566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 38053200 - 38053269
Alignment:
| Q |
29 |
ctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38053200 |
ctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
38053269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 38445430 - 38445519
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
38445430 |
tctttcaaaaagttgtggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccc |
38445519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 45231807 - 45231710
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||| || |||||| |
|
|
| T |
45231807 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaaccctcaatccatt |
45231710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 27432516 - 27432608
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagt |
93 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
27432516 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaagcagccgcctatgttttgattctttgacagttttgaacccccagt |
27432608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 32555588 - 32555500
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||| |||||||||||||| |
|
|
| T |
32555588 |
tctttcaaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttgacagttttggacccc |
32555500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 35924178 - 35924090
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
35924178 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggccccc |
35924090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 228238 - 228155
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
228238 |
aaaagttgcggttttggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
228155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 497145 - 497228
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
497145 |
aaaagttgcagttatggacccctaactaatttaaatacaaatcagccccctatgttttgattctttggcagttttggaccccca |
497228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 3235166 - 3235237
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
3235166 |
ccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtccatt |
3235237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 4061275 - 4061181
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || ||||| |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
4061275 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaacc-cctattttttgattctttggcagttttgaacccccagtcca |
4061181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 16537364 - 16537269
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||| ||||||| | ||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
16537364 |
tctttcgaaaagttgtggttatggactcctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttgaacccccagtcca |
16537269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 16628298 - 16628393
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||| ||||||| | ||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
16628298 |
tctttcgaaaagttgtggttatggactcctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttgaacccccagtcca |
16628393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 16879268 - 16879359
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttga-ttttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||| |||||||||| ||||||||||| |||||||| |
|
|
| T |
16879268 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgatttttttggcaattttggacccctagtccatt |
16879359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 3 - 98
Target Start/End: Original strand, 18363323 - 18363418
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||||||| ||||||||| | | |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
18363323 |
tttccaaaagttgcgattatggacccctaactaatttaaatacaaaacagtcccatatgttttgattctttggcagttttggaccctcagtccatt |
18363418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 23909928 - 23910011
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
23909928 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccatatgttttgattatttggcagttttggaccccca |
23910011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 23910135 - 23910052
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
23910135 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttgaaccccca |
23910052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 30141200 - 30141117
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30141200 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
30141117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 35121446 - 35121521
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
35121446 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttg |
35121521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 35121693 - 35121610
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
35121693 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacatccccctatgttttgattatttggcagttttggcccccca |
35121610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 36376349 - 36376266
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
36376349 |
tctttccaaaagttgcggttatggaaccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgg |
36376266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 38053428 - 38053345
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| || | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38053428 |
aaaagttgcggttatggacccctaactaatttaaatacaaaagagtcccctatgttttgattctttggcagttttggaccccca |
38053345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 10351086 - 10350996
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
10351086 |
aaaagttacggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggaccccaagttcatt |
10350996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 19194186 - 19194276
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||| ||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
19194186 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacataacagccccctatgttttgattctttggcagttttggcccccca |
19194276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 24775905 - 24775815
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||| ||| ||||||| ||||||||| |||||||||| |
|
|
| T |
24775905 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattctttggcaattttggacctccagtccatt |
24775815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 37452084 - 37452173
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
37452084 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagcc-cctatgttttgattctttgacagttttggacccgcagtccatt |
37452173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 44189664 - 44189559
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||| ||||||||| | | |||||||||||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
44189664 |
aaaagttgcggttatggtcccttaattaatttaaatacaaaacagtcccatatgttttgattctttggcagttttgga-ccccagtccattagtgaggtg |
44189566 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
|| |||| |
|
|
| T |
44189565 |
ccgcgtg |
44189559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 16537110 - 16537191
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | ||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
16537110 |
aaaagttgcggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttggccccc |
16537191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 16628552 - 16628471
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | ||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
16628552 |
aaaagttgcggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttggccccc |
16628471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 16705482 - 16705575
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| ||||| ||| ||||||| | ||||||||||||||| ||||||||| | | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16705482 |
tctttttaaaaattgtggttatggtctcctaactaatttaaatacaaaacagtcccatatgttttgattttttggcagttttggacccccagtc |
16705575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 17679718 - 17679811
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| ||||| ||| ||||||| | ||||||||||||||| ||||||||| | | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17679718 |
tctttttaaaaattgtggttatggtctcctaactaatttaaatacaaaacagtcccatatgttttgattttttggcagttttggacccccagtc |
17679811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 21782890 - 21782793
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||||| || | |||||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
21782890 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacaaccccttatgttttgattctttgccagttttggacccccagttcatt |
21782793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 30028663 - 30028582
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
30028663 |
aaaagttgtggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
30028582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 23358725 - 23358813
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||||| | || || |||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||| |
|
|
| T |
23358725 |
tctttctaaaagttgcggctgtggacctctaactaatttaaatacaaaatagtcccctatgttttgattttttggcagttttggacccc |
23358813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 26612623 - 26612547
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
26612623 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattttttgacagttttgg |
26612547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 45231555 - 45231635
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
45231555 |
aaaagttacggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccc |
45231635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 4061021 - 4061096
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||| |||||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
4061021 |
aaaagttgcggttatgaacccctaactgatttaaatacaaaacaaccccctatgttttgattctttggcagttttg |
4061096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 10318924 - 10319007
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
10318924 |
aaaagttgcagttatgaacccctaactaatttaaatacaaaacagtcccctatgttttgattctttgacagttttggcccccca |
10319007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 10350839 - 10350922
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||| | | |||||||||||||||||||||||||||||||||| |
|
|
| T |
10350839 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacaatcccttatgttttgattttttggcagttttggaccccca |
10350922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 18363574 - 18363491
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
18363574 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttgccagttttagaccccca |
18363491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 21917119 - 21917202
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||| || ||||||||||||| |
|
|
| T |
21917119 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttgacaattttggaccccca |
21917202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 30699304 - 30699221
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| |||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30699304 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacaaccctctatgttttgattctttggcagttttggaccccca |
30699221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 91
Target Start/End: Original strand, 37996054 - 37996133
Alignment:
| Q |
12 |
gttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37996054 |
gttgcggttatggacccctaactaatttaaatacaaaacaacccactatgttttgattctttggcagttttggaccccca |
37996133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 5097072 - 5096982
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5097072 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaaacagtcccctatgttttgattctttagcagttttggaccccca |
5096982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 16879525 - 16879435
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | |||| |||||||||| ||||||||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
16879525 |
tctttccaaaagttgcggttatggactcctagctaatttaaatacaaaacagccccttatgttttgattctttggtagttttggaccccca |
16879435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 27513080 - 27512999
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27513080 |
aaagttgcggttatggacccttaactaatttaaatacaaaacagcc-cctatgttttgattctttagcagttttggaccccca |
27512999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 9629038 - 9629135
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| | |||||||| || |||||||||||| ||| | |||||||||||| ||||||||| |
|
|
| T |
9629038 |
tctttttaaaagttgcggttatggaaccctaactaatttaaatataaaacagcttcttatgttttgattctttagtagttttggaccctcagtccatt |
9629135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 10319173 - 10319092
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| | ||| |||||||||||||||||||||| ||||| |
|
|
| T |
10319173 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagccccttatattttgattttttggcagttttgaacccc |
10319092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 3 - 83
Target Start/End: Complemental strand, 7195743 - 7195663
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||| | ||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
7195743 |
tttccaaaagttgcggttatggatccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttg |
7195663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 17757796 - 17757884
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| ||||||||| |||||| |||| |||||||||| ||| |||| |||||||||||||| |
|
|
| T |
17757796 |
tctttttaaaagttgcggttatggacccctaattaatttaaatacaaaatagccccctatgttttaattctttgacagttttggacccc |
17757884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 32555355 - 32555427
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
32555355 |
cccctaactaatttaagtacaaaacatccccctatgttttgattctttggcagttttggacctccagtccatt |
32555427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 48871375 - 48871295
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||| |||||||||||||||| || |||| ||||||||| ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
48871375 |
tctttccaaaagttgcggttatggacctctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttt |
48871295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 9035384 - 9035471
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
||||| ||||||||||||||||| || |||||||||||||| |||||||| || || ||||||||||| |||| ||||||||||||| |
|
|
| T |
9035384 |
tctttttaaaagttgcggttatggacctctaactaatttaaatacaaaacaacccccaatgttttgattctttgccagttttggaccc |
9035471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 25036065 - 25036148
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | |||||| || |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
25036065 |
aaaagttgcggttatggatccctaactaatttaaatataaaacaaccccctatgttttgattctttggcagttttggcccccca |
25036148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 30401188 - 30401117
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagt |
79 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
30401188 |
aaaagttgtggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagt |
30401117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 49081613 - 49081491
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| || ||||| ||||||||| ||||||||| | |||||||||||||| ||| |||||||| || | ||||||||| || |||||| |
|
|
| T |
49081613 |
aaaagttgcggttatggcctcctaattaatttaaatacaaaacagtcccctatgttttgattctttagcagtttttga-ctccagtccataagtgaggtg |
49081515 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|| | ||||||||||||||||| |
|
|
| T |
49081514 |
tcatatggccccctaaataataca |
49081491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 44 - 98
Target Start/End: Complemental strand, 21917331 - 21917277
Alignment:
| Q |
44 |
acaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21917331 |
acaaaacagccccctatgttttgattttttggcagttttggacccccggtccatt |
21917277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 42750976 - 42751066
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||| |||||||| || ||||||||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
42750976 |
aaaagttgtggttatggatctctaactaatttaaatacaaaacatccccctatgttttgattttttgacagttttggacactcagtccatt |
42751066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 23740297 - 23740378
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||| ||||||||||| ||||||||| |||| ||| ||||||||||||||| |
|
|
| T |
23740297 |
aaaagttgcggttatggacccttaattaatttaaatacaaaacagccccctatgtttggattctttagcagttttggacccc |
23740378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 89
Target Start/End: Complemental strand, 39977000 - 39976927
Alignment:
| Q |
16 |
cggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||| | |||||||||||| |||| |||||||||||||| |
|
|
| T |
39977000 |
cggttatgaatccctaactaatttaaatacaaaacagccccttatgttttgattctttgacagttttggacccc |
39976927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 3931781 - 3931733
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaa |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3931781 |
tctttctaaaagttgcggttatgaccccctaactaatttaaatacaaaa |
3931733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 388181 - 388106
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| ||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
388181 |
aaaagttgcggttatggatccctaattaatttaaatacaaaacagccccctatgttttgattctttgacagttttg |
388106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 98
Target Start/End: Complemental strand, 17758024 - 17757953
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||||| | | |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
17758024 |
ccctaactaatttaattacaaaacagtcccatatgttttgattctttggcagttttggacctccagtccatt |
17757953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 18201380 - 18201463
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
18201380 |
tctttctaaaagttgcgattttggccccctaactaattcaaatacaaaacagccccctatgtattggatctttggcagttttgg |
18201463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 38879437 - 38879350
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||| ||||||||||| |||| |||| ||||||||||| ||||||||||| |||||||||| ||| ||| |||||||||||||| |
|
|
| T |
38879437 |
tctttccaaaagttgcggctatggatccctgactaatttaaatacaaaacagccccctatgtttttattctttagcagttttggaccc |
38879350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 388003 - 388075
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| ||||||||| |||||| ||| | |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
388003 |
cccctaattaatttaaatacaaaatagctccttatgttttgattctttgacagttttggacccccagtccatt |
388075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 11742938 - 11742862
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || ||| ||||||||||||| ||| ||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
11742938 |
aaaagttgcgattttgatcccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttgg |
11742862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 23358981 - 23358897
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
||||||||||||||| |||||| || ||||||||||||| ||||||||| | | | |||||||||||||||||||||||||| |
|
|
| T |
23358981 |
tctttctaaaagttgttgttatggaccattaactaatttaaatacaaaacagtcccttgtgttttgattttttggcagttttgga |
23358897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 3 - 74
Target Start/End: Complemental strand, 3926043 - 3925973
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttg |
74 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||| |
|
|
| T |
3926043 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaacc-cctatgttttgattctttg |
3925973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 37991441 - 37991524
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||| ||||||||||| || ||||||||||| ||||| ||| ||||||||||||||||||| ||| | ||||||| |||||| |
|
|
| T |
37991441 |
tctttttaaaagttgcgattttgaccccctaattaattaaaatacaaaacagcctcctatgtattggatctttggcaattttgg |
37991524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 40790958 - 40790875
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
40790958 |
tctttccaaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
40790875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 3931679 - 3931725
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3931679 |
aaaagttggggttatgaccccctaactaatttaaatacaaaacagcc |
3931725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 1450430 - 1450342
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| |||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
1450430 |
tctttctaaaggttgcgattttggacccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
1450342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 21202889 - 21202802
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| || ||||||| ||||||||| ||| |||||||| |||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
21202889 |
tctttccaaaagttgcgattttgacccc-taactaattaaaatacaaaacaacctcctatgtattggatctttggcagttttggccccc |
21202802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 31530000 - 31530088
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||| |||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
31530000 |
tctttccaaaagatgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
31530088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 40139555 - 40139642
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| ||||||||||||||| |||| |
|
|
| T |
40139555 |
tctttctaaaagttgcgattttggccccctaactaattaaaatacaaaacaaccccctatgtgttg-gattttggcagttttggccccc |
40139642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 69
Target Start/End: Complemental strand, 44215007 - 44214947
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatt |
69 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| | || |||||||||||||| |
|
|
| T |
44215007 |
aaagttgcggttatggacccctaactaatttaaatacaaaataaccccctatgttttgatt |
44214947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 45260252 - 45260164
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || ||||||||||||| ||| ||||||||| | ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
45260252 |
tctttctaaaagttgcgattttggacccctaactaattaaaatacaaaacagtcccctatgtattggatctttggcagttttggccccc |
45260164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 45863258 - 45863170
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
45863258 |
tctttccaaaagttgcaattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
45863170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 91
Target Start/End: Original strand, 35711692 - 35711775
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatg-ttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||| | |||||| |||||||| |||| ||||||| ||||||| |
|
|
| T |
35711692 |
aaagttgcggttatggacccctaactaatttaaatacaaaacaatcccctatgtttttgattatttgcaagttttgcaccccca |
35711775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 42438055 - 42437976
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| |||||| |||| ||||||| ||| |||||||||||||||| |||| |
|
|
| T |
42438055 |
aagttgcgattttggccccctaactaattaaaatacaaaagagccccctatgtattggatttttggcagttttggccccc |
42437976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 48925944 - 48926019
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||||| ||||| ||| | ||||||||||||| |
|
|
| T |
48925944 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagcctcatatgtattggatctttggcagttttg |
48926019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 8 - 82
Target Start/End: Complemental strand, 20588435 - 20588361
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
20588435 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
20588361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 31530406 - 31530345
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| |||||||| | || ||||||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
31530406 |
tctttccaaaagttgggattttgaccccctaactaattaaaatacaaaacagccccctatgt |
31530345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 43632367 - 43632420
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||| |||| ||||||||||| || ||||||||||||||| ||||||||||| |
|
|
| T |
43632367 |
tctttccaaaaattgcggttatggcctcctaactaatttaaatacaaaacagcc |
43632420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 784552 - 784616
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
784552 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
784616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 22164952 - 22165040
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || ||||||| ||| ||||| ||| |||||||| || ||||||| ||| | ||||||| |||||| |||| |
|
|
| T |
22164952 |
tctttctaaaagttgcgattttgaccccttaattaattaaaatacaaaacaaccccctatgtattggatctttggcaattttggccccc |
22165040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 22223659 - 22223747
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || ||||||| ||| ||||| ||| |||||||| || ||||||| ||| | ||||||| |||||| |||| |
|
|
| T |
22223659 |
tctttctaaaagttgcgattttgaccccttaattaattaaaatacaaaacaaccccctatgtattggatctttggcaattttggccccc |
22223747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 8409126 - 8409209
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||| || || |||||||||||||| ||| |||||||||| ||||||| ||| | |||||||||||||| |||||| |
|
|
| T |
8409126 |
aaaagttgcaattttggccccctaactaattaaaatacaaaacagctccctatgtattggatctttggcagttttggcccccca |
8409209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 9629303 - 9629217
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| | |||||| || |||| |||| ||| | |||||||||| ||||| |
|
|
| T |
9629303 |
tctttccaaaagttgcggttatggacccctaactaatttaaatataaaacaaccctctatatttt-attctctggcagttttcgaccc |
9629217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 8409359 - 8409269
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||| || || || |||||||| | ||| ||||||||||| ||||||| ||| | |||||||||||||| |||||| |
|
|
| T |
8409359 |
tctttttaaaagttgcgattttggccttctaactaaataaaatacaaaacagccccctatgtattggatctttggcagttttggcccccca |
8409269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 89
Target Start/End: Original strand, 26763474 - 26763560
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| ||||||||||||| || || ||||||||||| ||| ||||||||||| ||| ||| ||| | ||||| |||||||| |||| |
|
|
| T |
26763474 |
tttccaaaagttgcggttttggcctcctaactaattaaaatacaaaacagccccctctgtattggatctttggtagttttggccccc |
26763560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 30503739 - 30503821
Alignment:
| Q |
8 |
aaaagttgcggttatgacccc-ctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||| |||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
30503739 |
aaaagttgcgattttgccccctctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
30503821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 1450009 - 1450070
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| ||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
1450009 |
tctttcaaaaagttgcaattttggccccctaactaattaaaatacaaaacagccccctatgt |
1450070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 74 - 111
Target Start/End: Original strand, 49081452 - 49081489
Alignment:
| Q |
74 |
ggcagttttggacccccagtccattagcgaggtgccac |
111 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
49081452 |
ggcagttttggacccccagtctattagtgaggtgccac |
49081489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 5181711 - 5181659
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctat |
60 |
Q |
| |
|
|||| |||| |||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
5181711 |
aaaaattgcagttatggacccctaactaatttaaatacaaaacagccccctat |
5181659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 42437980 - 42437916
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
42437980 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttgacagttttggccccc |
42437916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 43724595 - 43724671
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||| ||||| |||||| ||| | |||||||||||||| |
|
|
| T |
43724595 |
aaaagttgcgattttggccccctaactaattaaaatacaaatcagccccctatgcattggatctttggcagttttgg |
43724671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 215)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 26434977 - 26434843
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26434977 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaatagccccctatgttttgattttttggtagttttggacccccagtccattag |
26434878 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
26434877 |
tgaggtgccacgtggccccctaaataatacacgtg |
26434843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 45664427 - 45664293
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45664427 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattttttggcagttttggacccccagtccattag |
45664328 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
45664327 |
tgaggtgccacgtggccccctaaataatacacgtg |
45664293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 3 - 134
Target Start/End: Complemental strand, 43670599 - 43670467
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcg |
102 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||| |||||| |||| | ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43670599 |
tttccaaaagttgcggttatggccccctaactaatttaaatacaaaatagccacatatgttttgattttttggcagttttggacccccagtccattagtg |
43670500 |
T |
 |
| Q |
103 |
aggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
43670499 |
aggtgccacgtggccccctaaataatacacgtg |
43670467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 27855830 - 27855696
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27855830 |
tctttctaaaagttacggttatgatcctctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagttcattag |
27855731 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| |
|
|
| T |
27855730 |
tgaggtgccacgtggccctctaaataatacacgtg |
27855696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 9 - 134
Target Start/End: Complemental strand, 42589681 - 42589555
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgc |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
42589681 |
aaagttgcggttatggccccctaactaatttaaatacaaaacagcctcttatgttttgattttttggcagttttggacccccggtccattagtgaggtgc |
42589582 |
T |
 |
| Q |
109 |
cacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||| | ||||||||||||||||||| |
|
|
| T |
42589581 |
cacgtggtcccctaaataatacacgtg |
42589555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 52233457 - 52233590
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || ||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52233457 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaacc-cctatattttgattttttggcagttttggactcccagtccattag |
52233555 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
52233556 |
tgaggtgccacgtggccccctaaataatacacgtg |
52233590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 3383997 - 3384119
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3383997 |
aaaagttgcggttattgccccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggacccccagtccattaatgaggtg |
3384096 |
T |
 |
| Q |
108 |
ccacgtgccccctaaataataca |
130 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
3384097 |
ccacgtggcccctaaataataca |
3384119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 18589875 - 18590005
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| |||| ||||| |
|
|
| T |
18589875 |
tctttccaaaagttgcggttatggtcccctaactaatttaaatacaaaacagcctcatatgttttgattatttggcagttttggaccctcagttaattag |
18589974 |
T |
 |
| Q |
101 |
cgaggtgccacgtg-ccccctaaataataca |
130 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
18589975 |
tgaggtgccacgtgcccccctaaataataca |
18590005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 27855596 - 27855701
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27855596 |
aaaagttgcggttatgacccc-taactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
27855694 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
27855695 |
ccacgtg |
27855701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 40815146 - 40815020
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||| |||||||||||||| || ||| |
|
|
| T |
40815146 |
aaaagttgcggttatggctccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttgga-ccccagtccattagtgaagtg |
40815048 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
40815047 |
ccacgtggccccctaaataatacacgtg |
40815020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 4243156 - 4243253
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4243156 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
4243253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 14460589 - 14460492
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14460589 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
14460492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 23356719 - 23356816
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23356719 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccatt |
23356816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 26434735 - 26434848
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
26434735 |
tctttccaaaagttacggttatgaccccctaattaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccctgtccattag |
26434834 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26434835 |
tgaggtgccacgtg |
26434848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 43677129 - 43677226
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43677129 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
43677226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 52233692 - 52233585
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc-tcctatgttttgattttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || ||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52233692 |
aaaagttgcggttatggtcccctaactaatttaaatacaaaacaaccctcctatgttttgattatttggcagttttggacccccagtccattagtgaggt |
52233593 |
T |
 |
| Q |
107 |
gccacgtg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
52233592 |
gccacgtg |
52233585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11204533 - 11204630
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11204533 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
11204630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 13791602 - 13791699
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13791602 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
13791699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 33811451 - 33811548
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33811451 |
tctttctaaaagttgcggtcatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
33811548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 33870920 - 33871017
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33870920 |
tctttctaaaagttgcggtcatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
33871017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 36139644 - 36139547
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36139644 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
36139547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 36230578 - 36230691
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||| ||||||||||| | || ||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
36230578 |
tctttccaaaagttgcggttatggccctctaactaatttaaatacaaaacagccccttacgttttgattctttggcagttttggaccctcagtccattag |
36230677 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36230678 |
tgaggtgccacgtg |
36230691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 40814912 - 40815025
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
40814912 |
tctttccaaaagttgcggttatggccccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtctattac |
40815011 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40815012 |
tgaggtgccacgtg |
40815025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 45012658 - 45012763
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45012658 |
tctttccaaaagttgcggttatagccccctaactaatttaaatacaaaacagacccctatgttttgattctttggcagttttggacccccagtccattag |
45012757 |
T |
 |
| Q |
101 |
cgaggt |
106 |
Q |
| |
|
||||| |
|
|
| T |
45012758 |
tgaggt |
45012763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 47113414 - 47113511
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47113414 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
47113511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 10279964 - 10279831
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| || ||| ||||||||| ||||||||||| ||||| |||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
10279964 |
tctttccaaaagttgcggttatggtcct-taattaatttaaatacaaaacagccccctatattttgattttttggcagttttgaacctccaatccattag |
10279866 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
10279865 |
tgaggtgccacgtggccccctaaataatacacgtg |
10279831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 13098064 - 13098154
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
13098064 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccctagtccatt |
13098154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 22204338 - 22204428
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22204338 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
22204428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 30289195 - 30289305
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| | |||| | |||| |||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
30289195 |
tctttccaaaagttgtggttatgaccccctaactaatttaaatataaaatatcctcatatgttttgattatttggcagttttggacccccaatccattag |
30289294 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
30289295 |
tgaggtgccac |
30289305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 42406916 - 42407006
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42406916 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
42407006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 52149550 - 52149640
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52149550 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagtttgggacccccagtccatt |
52149640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 6183008 - 6183105
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6183008 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
6183105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 8535803 - 8535706
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8535803 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggaccctcagtccatt |
8535706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 8601042 - 8600945
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
8601042 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggaccctcagtccatt |
8600945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 9517533 - 9517436
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
9517533 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccctcagtccatt |
9517436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 30294896 - 30294993
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30294896 |
tctttctaaaagttgcggttatggatccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacccccagtccatt |
30294993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 45664185 - 45664298
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||||||||||| ||| |||||||||||||| |||||||| || |||||||||||||| |||| |||||||||| ||| |||||||||| |
|
|
| T |
45664185 |
tctttttaaaagttgcggttatggccctctaactaatttaaatacaaaacaaccccctatgttttgattctttgacagttttggatccctagtccattag |
45664284 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
45664285 |
tgaggtgccacgtg |
45664298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 45885236 - 45885139
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
45885236 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtccatt |
45885139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 49056150 - 49056247
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
49056150 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggtagttttggacccccaatccatt |
49056247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 8770748 - 8770653
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8770748 |
tttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
8770653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 3 - 98
Target Start/End: Complemental strand, 44847199 - 44847104
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44847199 |
tttcaaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
44847104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 7598886 - 7598796
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7598886 |
aaaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
7598796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 8774584 - 8774494
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8774584 |
tctttccaaaagttgcagttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
8774494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 9053682 - 9053592
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
9053682 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
9053592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 18590117 - 18590007
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||| ||||||| | |||||||||||||||| |||||| || | | |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18590117 |
tctttttaaaagttgtggttatggctccctaactaatttaaatacaaaagagtcccttatgttttgattttttggcagttttggacccccagttcattag |
18590018 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
18590017 |
tgaggtgccac |
18590007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 28503168 - 28503258
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28503168 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattatttggcagttttggacccccagtccatt |
28503258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 30288479 - 30288389
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
30288479 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaatagccccctatgttttgattctttggtagttttggacccccagtccatt |
30288389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 34988123 - 34988213
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||| ||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
34988123 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctaagttttgattctttggcagttttggaccctcagtccatt |
34988213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 40355881 - 40355971
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40355881 |
aaaagttgcggttatggacccctaactaacttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
40355971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 41585318 - 41585408
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41585318 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
41585408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 8774324 - 8774420
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8774324 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttga-tttttggcagttttggacccccattccatt |
8774420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 20471440 - 20471537
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
20471440 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacccgcagtccatt |
20471537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20560097 - 20560000
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
20560097 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacccgcagtccatt |
20560000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 26861300 - 26861397
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
26861300 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccaagtccatt |
26861397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 43914604 - 43914701
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
43914604 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
43914701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 51272965 - 51272868
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
51272965 |
tctttcaaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttgtcagttttggacccccagtccatt |
51272868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 23342248 - 23342160
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23342248 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
23342160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 14773 - 14856
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14773 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
14856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 6809101 - 6809184
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6809101 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccacctatgttttgattctttggcagttttggaccccca |
6809184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 3 - 114
Target Start/End: Original strand, 10279725 - 10279836
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcg |
102 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| | |||||| || |||||||||||||| |||||||| |||||||| |||||||||||| | |
|
|
| T |
10279725 |
tttctaaaagttggaattatggccccctaactaatttaaatataaaacaaccccctatgttttgattctttggcagctttggacctccagtccattagtg |
10279824 |
T |
 |
| Q |
103 |
aggtgccacgtg |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10279825 |
aggtgccacgtg |
10279836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 13791855 - 13791772
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13791855 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccacctatgttttgattctttggcagttttggaccccca |
13791772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 15161585 - 15161490
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15161585 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaagcagccccctatgttttgattctttggcagttttgaacccccagtcca |
15161490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 16491007 - 16491090
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
16491007 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
16491090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 23208341 - 23208424
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23208341 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggaccccca |
23208424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 42589453 - 42589560
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga-cccccagtccattagcgaggt |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||| ||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
42589453 |
aaaagttgcggttatggccccctaactaatttaattacaaaacagacctctatgttttgattctttagcagttttggaccccccagtccattagtgaggt |
42589552 |
T |
 |
| Q |
107 |
gccacgtg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
42589553 |
gccacgtg |
42589560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7598635 - 7598725
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7598635 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
7598725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 11018427 - 11018517
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
11018427 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggcccccca |
11018517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 11052184 - 11052094
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
11052184 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
11052094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 11204786 - 11204696
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
11204786 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
11204696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 14460327 - 14460417
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14460327 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
14460417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 19830398 - 19830308
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19830398 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
19830308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 20471699 - 20471609
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
20471699 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcatcctatgttttgattctttgacagttttggaccccca |
20471609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20559838 - 20559928
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
20559838 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcatcctatgttttgattctttgacagttttggaccccca |
20559928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 27396813 - 27396723
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27396813 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatattttgattttttggcagttttggaccccca |
27396723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 32341521 - 32341611
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
32341521 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccca |
32341611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 34988373 - 34988283
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
34988373 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttgaaccccca |
34988283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 39427444 - 39427534
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39427444 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
39427534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 39427700 - 39427610
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
39427700 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggaccccca |
39427610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 42407172 - 42407082
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
42407172 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
42407082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 45680370 - 45680280
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
45680370 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtctcctatgttttgattctttggcagttttggaccttcagtccatt |
45680280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 52143191 - 52143281
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52143191 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
52143281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 11051922 - 11052019
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11051922 |
tctttccaaaagttgcggttattgacccctaactaatttaaatacaaaacagccccttatgttttgattctttagcagttttggacccccagtccatt |
11052019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 12690047 - 12690143
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
12690047 |
tctttccaaaagttgaggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgga-ccccagtccatt |
12690143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 20017408 - 20017505
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||| ||||||| ||||||||||||||||| ||||||||| |||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
20017408 |
tctttccaaaagttacggttatagtcccctaactaatttaaatacaaaacagtctcctatgttttgattctttggcagttttggacccccagttcatt |
20017505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20596150 - 20596053
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||| |||||||||| |||| |
|
|
| T |
20596150 |
tctttccaaaagttgcggttatggacccctaactaatttaaaaacaaaacagccccctatgttttgattcttttgcagttttcgacccccagttcatt |
20596053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 21727638 - 21727735
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| |||||||| || |||||||||||||| ||||||||||| | |||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21727638 |
tctttccaaaagttgtggttatgaacctctaactaatttaaatacaaaacagccccatatggtttgattctttggcagttttggacccccagtccatt |
21727735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 23208593 - 23208496
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||| | ||||||| ||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23208593 |
tctttccaaaagttgcggttacggacccctaattaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
23208496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 23793069 - 23792972
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| ||||||||||| | |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
23793069 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttctggacccccagtccatt |
23792972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 25098417 - 25098322
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25098417 |
tctttccaaaagttgcggttatggaccc-taactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggacccccagtccatt |
25098322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 32038126 - 32038029
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||| |||||| || | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32038126 |
tctttctaaaagttgtggttatagacccctaactaatttaaatacaaaatagtcccctatgttttgattctttggcagttttggacccccagtccatt |
32038029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2371203 - 2371291
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| | ||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
2371203 |
tctttcaaaaagttgcggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttggacccc |
2371291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 36139392 - 36139480
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
36139392 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccc |
36139480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 40356136 - 40356048
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
40356136 |
tctttttaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
40356048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 27 - 98
Target Start/End: Complemental strand, 14999 - 14928
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14999 |
ccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
14928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 6183262 - 6183179
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6183262 |
aaaagttgcggttaaggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
6183179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 8770496 - 8770579
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8770496 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
8770579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 21727895 - 21727812
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21727895 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggaccccca |
21727812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 28503416 - 28503333
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
28503416 |
aaaagttacggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattttttggcagttttggaccccca |
28503333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 38622683 - 38622600
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
38622683 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggactccca |
38622600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 43677382 - 43677300
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||| |||||||||||| |
|
|
| T |
43677382 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcag-tttggaccccca |
43677300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 45884981 - 45885064
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45884981 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggaccccca |
45885064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 47113667 - 47113584
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47113667 |
aaaatttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
47113584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 49227153 - 49227236
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
49227153 |
aaaagttgcggttatggacccctaactaatttatatacaaaacagtctcctatgttttgattctttggcagttttggaccccca |
49227236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 52363466 - 52363371
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| | ||||||||||||||| |||||||| ||||||||||||| ||| | |||||| |
|
|
| T |
52363466 |
tctttccaaaagttgcggttatgaacccctaactaatttaaataaaaaacagcctcctatattttgattctttggcagttttgaacctcaagtcca |
52363371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 3264026 - 3264116
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
3264026 |
tctttccaaaagttacggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggaccccca |
3264116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 6491696 - 6491606
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| || |||||||| ||||||||||| |
|
|
| T |
6491696 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacatttttggactcccagtccatt |
6491606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 6809349 - 6809263
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6809349 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattctttggcagttttggacccccagtc |
6809263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 9058192 - 9058282
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
9058192 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggtagttttggaccccca |
9058282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 20224111 - 20224201
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
20224111 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccttcagtccatt |
20224201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 22071196 - 22071285
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| | ||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22071196 |
aaaagttgcggttatggacccataactaatttaaatataaaacagcctcctat-ttttgattttttggcagtttttgacccccagtccatt |
22071285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 28 - 98
Target Start/End: Complemental strand, 29704876 - 29704806
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
29704876 |
cctaactaatttaaatacaaaacagcctcctatgttttgattctttggcagttttggaccctcagtccatt |
29704806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 37028961 - 37029051
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
37028961 |
aaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttggacccccggtccatt |
37029051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 37029215 - 37029125
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
37029215 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttagaccccca |
37029125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 41585572 - 41585482
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
41585572 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagcaccctatgttttaattctttggcagttttggaccccca |
41585482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 46320963 - 46320873
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
46320963 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttagcagttttggaccccca |
46320873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 49056409 - 49056319
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
49056409 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
49056319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 9 - 91
Target Start/End: Original strand, 51272711 - 51272793
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
51272711 |
aaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattctttggcagttttggaccccca |
51272793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 52143445 - 52143355
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
52143445 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagacctctatgttttgattctttgacagttttggacccccagtccatt |
52143355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 8028993 - 8029074
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
8028993 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
8029074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 29794719 - 29794816
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||| ||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
29794719 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctaagttttgattctttggcaaatttggacccccagtccatt |
29794816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 9058429 - 9058357
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
9058429 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
9058357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 11018682 - 11018594
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
11018682 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagctccctatgttttgattctttggcagttttgaacccctagtcca |
11018594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 30288233 - 30288321
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| | |||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
30288233 |
tctttccagaagttgcggttatggacccctaactaatttaaatacaaaacagctccctatgttttgattctttggcagttttggacccc |
30288321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 30289434 - 30289307
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||||||||||||| |||||||||| ||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
30289434 |
tctttccaaaagttacggttatggtcccataactaatttaaatacaaaacagcactctatgttttgattatttagcatttttggacccccagtccattag |
30289335 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataataca |
130 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
30289334 |
---tgtgccacgtggccccctaaataataca |
30289307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 10 - 98
Target Start/End: Original strand, 38622438 - 38622526
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| |||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
38622438 |
aagttgcagttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacctccagtccatt |
38622526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 47764124 - 47764212
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
47764124 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccacctatgttttgattctttggcagttttgaacccctagtcca |
47764212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 2 - 94
Target Start/End: Complemental strand, 49227402 - 49227310
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| |||||| ||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
49227402 |
ctttccaaaagtcgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggactcccagtc |
49227310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 9053434 - 9053517
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
9053434 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggtagttttggaccccca |
9053517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 9517283 - 9517366
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||| |||||||| |
|
|
| T |
9517283 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttagaccccca |
9517366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 32558238 - 32558320
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
32558238 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttgg |
32558320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 45680124 - 45680207
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
45680124 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagacccttatgttttgattctttggcagttttggaccccca |
45680207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 52149794 - 52149711
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
52149794 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
52149711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 15161323 - 15161409
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
15161323 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttagacc |
15161409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 23341997 - 23342082
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
23341997 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatg-tttgattctttggcagttttggacccctagtc |
23342082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 32341772 - 32341682
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||||| ||||||| ||||||| |||||| |
|
|
| T |
32341772 |
aaaagttgcggttatggacccctaactaatttaaatgcaaaacagccccctatgttttgattctttggtagttttgaacccccattccatt |
32341682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 12071670 - 12071762
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
12071670 |
tctttcaaaaagttgcggttatggactcctaactaatttaaatacaaaacagcc-cctatgttttgattctttgacagttttgaacccccagtc |
12071762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 20224356 - 20224275
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||| ||||||||||||||| |
|
|
| T |
20224356 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattgttttgcagttttggacccc |
20224275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 23356974 - 23356893
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
23356974 |
aaaagttgcggttatggacctctaactaatttaaatacaaaatagccccctatgttttgattatttggcagttttggacccc |
23356893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 26861553 - 26861472
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||| | | |||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26861553 |
aaaagttgcggttataaatctctaactaatttaaatataaaacagtctcctatgttttgattttttggcagttttggacccc |
26861472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 44846951 - 44847032
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| | ||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
44846951 |
aaaagttgcggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttagcagttttggacccc |
44847032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 3264263 - 3264191
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3264263 |
cccctaactaatttaaatacaaaacaaccctctatgttttgattctttggcagttttggacccccagtccatt |
3264191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 8535556 - 8535640
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
8535556 |
tttctaaaagttgtggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacc |
8535640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 87
Target Start/End: Original strand, 8600795 - 8600879
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
8600795 |
tttctaaaagttgtggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacc |
8600879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 16491255 - 16491167
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
16491255 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttgaaccctcagtcca |
16491167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 29794974 - 29794894
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || | |||||||||||| |||||||||||||||||| |
|
|
| T |
29794974 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccttatgttttgattctttggcagttttggaccc |
29794894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 29704650 - 29704733
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||| |||||||||||||||| |
|
|
| T |
29704650 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacagccccttatgttttgattctttgacagttttggaccccca |
29704733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 43914860 - 43914781
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
43914860 |
aaaagttgtggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacc |
43914781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 20359285 - 20359195
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| |||||||||| |||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
20359285 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacagcaccctatgttttgattctttggcagttttagactccca |
20359195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20551685 - 20551775
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| |||||||||| |||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
20551685 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacagcaccctatgttttgattctttggcagttttagactccca |
20551775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 23792806 - 23792896
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| | |||||||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
23792806 |
tctttccaaaagttgcggttatggacctctaactaatttaaatataaaacagctccctatgttttgattctttggcagttttagaccccca |
23792896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 31797090 - 31797180
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||| ||||||||||| |||| |||||||||||| ||||||||||| |||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
31797090 |
tctttccaaaaattgcggttatggaccccaaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggcccccca |
31797180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 921779 - 921840
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
921779 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagcctcctatgt |
921840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 2372699 - 2372610
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaac-agcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||| | || |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
2372699 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacaacccccctatgttttgattctttggcagttttgaacccc |
2372610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 2383372 - 2383461
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaac-agcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||| | || |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
2383372 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacaacccccctatgttttgattctttggcagttttgaacccc |
2383461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 27396554 - 27396650
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||||||||||| ||||||| || |||||||||||||| |||||||||||||||| |||| |||||| |
|
|
| T |
27396554 |
tctttctaaaagttgtggttatggactcctaactaatttaaatacaaaactacc-cctatgttttgattctttggcagttttggactcccaatccatt |
27396650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 46320709 - 46320790
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
46320709 |
aaaagttgcggttatggatccataactaatttaaatacaaatcagccccctatgttttgattctttggcagttttggacccc |
46320790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 922450 - 922362
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| | |||||||||||| |||| ||||||||| |||| |
|
|
| T |
922450 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccatatgttttgattctttgacagttttggccccc |
922362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 38 - 98
Target Start/End: Original strand, 19830171 - 19830231
Alignment:
| Q |
38 |
ttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19830171 |
ttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
19830231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 6491449 - 6491528
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||| ||||||| ||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
6491449 |
aaaagttgcggttatgaacccctaacaaatttaaatacaaaacggccccctatgttttgattctttcacagttttggacc |
6491528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 27 - 98
Target Start/End: Complemental strand, 20288009 - 20287938
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
20288009 |
ccctaactaatttaaatacaaaacaaccccctatgttttgattctttgacagttttggacccccggtccatt |
20287938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 22071421 - 22071358
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
22071421 |
cccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccc |
22071358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 32037876 - 32037959
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32037876 |
aaaagttgtggttatggatctctaactaatttaaatacaaaagagccccctatgttttgattctttggcagttttggaccccca |
32037959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 33811686 - 33811623
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33811686 |
cctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
33811623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 33871156 - 33871093
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
33871156 |
cctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggaccccca |
33871093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4243414 - 4243325
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
4243414 |
tctttttaaaagttgcggttatg-gatcctaactaatttaaatgcaaaacagccccctatattttgattctttggcagttttggaccccca |
4243325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 8029244 - 8029154
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||| ||||||||| | ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
8029244 |
tctttccaaaagttgcagttatggatccctaactaatttaaatacaaaacagtcccctatgttttgatactttagcagttttggaccccca |
8029154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 22204593 - 22204503
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | ||||| ||||||||| ||||||||||| ||| |||||||||| |||| |||||||||| ||||| |
|
|
| T |
22204593 |
tctttccaaaagttgcggttatggactcctaattaatttaaatacaaaacagccccctctgttttgattctttgccagttttggatcccca |
22204503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 12071932 - 12071847
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| |||||||| || | |||||||||||| ||| |||||||||||| |
|
|
| T |
12071932 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacaaccccttatgttttgattctttagcagttttggac |
12071847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 1480532 - 1480449
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||| |||| |||||||||| |
|
|
| T |
1480532 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagcc-cctatattttgattatttgacagttttgga |
1480449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 66
Target Start/End: Original strand, 20287794 - 20287858
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||||| |
|
|
| T |
20287794 |
ctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaatagccccctatgttttg |
20287858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 30295157 - 30295070
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
||||||||||||||| |||||| ||| | ||||||||||| ||||||||||| ||| ||||||||| |||||||||||||||||||| |
|
|
| T |
30295157 |
tctttctaaaagttgtggttatagaccctttactaatttaaatacaaaacagccccct--gttttgattctttggcagttttggaccccc |
30295070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 21932068 - 21931987
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
21932068 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttggccccc |
21931987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 52363229 - 52363294
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
52363229 |
cccctaactaatttaaatacaaaacagcccaatatgttttgattctttggcagttttggcccccca |
52363294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 2371457 - 2371381
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaac-agcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||| | || |||||||||||||| ||||||||||||| |
|
|
| T |
2371457 |
aaaagttgcggttatggacccctaaataatttaaatacaaaacaacccccctatgttttgattctttggcagttttg |
2371381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 20017664 - 20017576
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| ||||| | |||||||||||||| | ||||||| | |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
20017664 |
tctttccaaaagttgcgtttatggacttctaactaatttaaatataaaacagtcccctatgttttgattctttagcagttttggacccc |
20017576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 13099321 - 13099238
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||| ||| ||| |||||||| |||| || ||||||||||||| |
|
|
| T |
13099321 |
aaaagttgcggttatggttccctaactaatttaaatacaaaacaatctcttatattttgattctttgacaattttggaccccca |
13099238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 2 - 90
Target Start/End: Complemental strand, 25820839 - 25820751
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
||||| |||||||||||||| | || |||||||||||||| ||||||||| | | ||||||| |||| |||| |||||||||||||| |
|
|
| T |
25820839 |
ctttccaaaagttgcggttacggacctctaactaatttaaatacaaaacagacccttatgtttggattctttgttagttttggaccccc |
25820751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 34867743 - 34867671
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
34867743 |
cccctaactaatttaaatggaaaacagccctttgtgttttgattctttggcagttttgaacccccagtccatt |
34867671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 6606980 - 6606905
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |||| | |||||||| |||| |
|
|
| T |
6606980 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattgaatctttggcagctttg |
6606905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 51549403 - 51549340
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| |||| | |||||||||||||| |||| |
|
|
| T |
51549403 |
cccctaactaattaaaatacaaaacagccccctatgtattgaatctttggcagttttggccccc |
51549340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 3 - 65
Target Start/End: Original strand, 40618758 - 40618819
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgtttt |
65 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||||||||| ||||||||||| | |||||||| |
|
|
| T |
40618758 |
tttccaaaagttgcggttatggcccc-taactaatttaaatacaaaacagccccttatgtttt |
40618819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 2 - 91
Target Start/End: Original strand, 25820137 - 25820226
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| |||||||||||||| | || |||||||||||||| ||||||||| | | ||||||| |||| |||| |||||| |||||||| |
|
|
| T |
25820137 |
ctttccaaaagttgcggttacggacctctaactaatttaaatacaaaacagacccttatgtttggattctttgttagttttagaccccca |
25820226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 26063970 - 26064035
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgt-tttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| || ||| ||||||||||||||| |||| |
|
|
| T |
26063970 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatcttttggcagttttggccccc |
26064035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 82
Target Start/End: Complemental strand, 4476220 - 4476148
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||| || || |||||||| ||||| ||| ||||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
4476220 |
aagttgcgattttggccccctaattaattaaaatacaaaacagcctcctatgtattggatctttggcagtttt |
4476148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 15911983 - 15911907
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||| | ||| | |||||||||||||| |
|
|
| T |
15911983 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatatattggatctttggcagttttgg |
15911907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 35580764 - 35580852
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| || || |||| ||| ||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
35580764 |
tctttccaaaagttgcgattttggccccgtaattaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
35580852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 35580949 - 35580873
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || || ||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
35580949 |
aaaagttgcgattttggcctcctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
35580873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 83
Target Start/End: Original strand, 41611269 - 41611349
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||| |||||||||| || || |||||||||||||| ||| |||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
41611269 |
tttccaaaagttgcgattttggccccctaactaattaaaatgcaaaacagccccctatgtattggatctttggcagttttg |
41611349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 50504755 - 50504691
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
50504755 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
50504691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 51549344 - 51549280
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| |||||||| || ||||||| |||| ||||| |||||||||| |||| |
|
|
| T |
51549344 |
ccccctaactaattaaaatacaaaacaaccccctatgtattgaatttttagcagttttggccccc |
51549280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 52201398 - 52201474
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |
|
|
| T |
52201398 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttgg |
52201474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 6742934 - 6742997
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| |||||||| |||||||||| |||| | ||||||| |||||| |||| |
|
|
| T |
6742934 |
cccctaactaattaaaatacaaaacaacctcctatgtattgaatctttggcaattttggccccc |
6742997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 89
Target Start/End: Original strand, 22182432 - 22182499
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||| ||||| ||| | |||||||||||||| |||| |
|
|
| T |
22182432 |
tgaccccctaactaattaaaatacaaaacagtctcatatgtattggatctttggcagttttggccccc |
22182499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 49695385 - 49695464
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| || || |||||||| ||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
49695385 |
aagttgcgattttggccccctaattaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
49695464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 51195677 - 51195760
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||| ||||| || || |||||| ||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |
|
|
| T |
51195677 |
tctttctaaaaattgcgattttggccccctgactaattaaaatacaaaacagccccctatgtattggatctttgtcagttttgg |
51195760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 51463135 - 51463068
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
51463135 |
tgaccccctaattaattaaaatacaaaacagccccctatgtattggatatttggcagttttggccccc |
51463068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 1712403 - 1712477
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||| || || ||| |||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
1712403 |
aaaagttgcgattttggccctctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
1712477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 36196843 - 36196925
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||| || || || | | ||||||||| ||| ||||||||| ||||||||| |||| | ||||||||||||| |
|
|
| T |
36196843 |
tctttctaaaagttacgattttggtctcttaactaattaaaatacaaaacagtctcctatgtattgaatctttggcagttttg |
36196925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 48332980 - 48332922
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
48332980 |
cccctaactaattaaaatacaaaacagcctcctatgtattggatcattggcagttttgg |
48332922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 26 - 84
Target Start/End: Original strand, 51548403 - 51548461
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||| ||| ||||||||||| | ||| | |||| |||||||||||||||| |
|
|
| T |
51548403 |
cccctaactaattaaaatacaaaacagccccttatatattgaatttttggcagttttgg |
51548461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 6606568 - 6606649
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| | || || ||| |||||||||| ||| ||||||||||| |||||| |||| | |||||||||||||| |||| |
|
|
| T |
6606568 |
aaaagttgtgattttggccctctaactaattaaaatacaaaacagccctctatgtattgaatctttggcagttttggccccc |
6606649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Original strand, 7057039 - 7057095
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||||||| ||| |||||||| | |||||||| |||| |||||||||||||| |
|
|
| T |
7057039 |
ccccctaactaattaaaatacaaaacaac-tcctatgtattgaatttttggcagtttt |
7057095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 13344456 - 13344375
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||||||||||||| ||| |||||||| || ||||||| |||| | |||| ||||||||| |||| |
|
|
| T |
13344456 |
aaaagttgcgattttggtcccctaactaattaaaatacaaaacaaccccctatgtattgaatctttgacagttttggccccc |
13344375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 36500767 - 36500691
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
||||||||||||||||| || ||| ||||||||| ||||||||||| |||| |||||||| ||| |||||||||| |
|
|
| T |
36500767 |
aaaagttgcggttatgaatcc-taattaatttaaatacaaaacagccctctatattttgattggttgacagttttgga |
36500691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 50503736 - 50503809
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| ||||||||||| |||||| ||| | ||||||||||||| |
|
|
| T |
50503736 |
aagttgcgattttggccccctaactaattaaaatacaaaacagccctctatgtattggatctttggcagttttg |
50503809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 52254516 - 52254577
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
||||||||||| ||||| || || ||| |||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
52254516 |
tctttctaaaaattgcgattttggccctctaactaattaaaatacaaaacagccccctatgt |
52254577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 7058327 - 7058263
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | ||||| ||| | |||||||||||||| |||| |
|
|
| T |
7058327 |
ccccctaactaattaaaatacaaaacagccccttatgtaatgaatctttggcagttttggccccc |
7058263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 7489559 - 7489623
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| | ||||| |||| | ||||| |||||||| |||| |
|
|
| T |
7489559 |
ccccctaactaattaaaatacaaaacagccccttatgtattgaatctttggtagttttggccccc |
7489623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 9332936 - 9332987
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctat |
60 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
9332936 |
aaaagttgcggttatggaccc-taactaatttaaatacaaaacagccccctat |
9332987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 9356709 - 9356760
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctat |
60 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
9356709 |
aaaagttgcggttatggaccc-taactaatttaaatacaaaacagccccctat |
9356760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 62
Target Start/End: Original strand, 21931804 - 21931844
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
21931804 |
tgaccccctaactaattaaaatacaaaacagccccctatgt |
21931844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 29153227 - 29153279
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctat |
60 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||| |
|
|
| T |
29153227 |
aaaagttgcgattttgcccccctaactaattaaaatacaaaacagccccctat |
29153279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Original strand, 39277073 - 39277133
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
39277073 |
tgaccccctaactaattaaaataaaaaacagccccctatgtattggatctttggcagtttt |
39277133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 49695460 - 49695524
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||| | ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
49695460 |
ccccctaactaattaaaatacaaaacagtcccctatgtattggatctttggcagttttggccccc |
49695524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 51195943 - 51195879
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
51195943 |
ccccttaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
51195879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 189)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 41015071 - 41014944
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41015071 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
41014972 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
41014971 |
ccacgtggccccctaaataatacacgtg |
41014944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 40918661 - 40918527
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
40918661 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccctctatgttttgatcttttggcaattttggacccccagtccattag |
40918562 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40918561 |
tgatgtgccacgtggccccctaaataatacacgtg |
40918527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 5577352 - 5577479
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5577352 |
aaaagttgcggttatgaccccctaattaatttaaatataaaacagccctctatgttttgattttttggcagttttggacccccagtccattagtgaggtg |
5577451 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| || |||||||||||||||||| |
|
|
| T |
5577452 |
ccacgtggctccctaaataatacacgtg |
5577479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 20791042 - 20791177
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg-attttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20791042 |
tctttccaaaagttgcggttatggtcctctaactaatttaaatacaaaacagccccctatgttttgtattttttggcagttttggacccccagtccatta |
20791141 |
T |
 |
| Q |
100 |
gcgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
20791142 |
gtgaggtgccacgtggccccctaaataatacacgtg |
20791177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 8 - 133
Target Start/End: Original strand, 41554640 - 41554766
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
41554640 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccctagtccattagtgaggtg |
41554739 |
T |
 |
| Q |
108 |
ccacgtg-ccccctaaataatacacgt |
133 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
41554740 |
ccacgtgcccccctaaataatacacgt |
41554766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 17943391 - 17943518
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17943391 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattaatgaggtg |
17943490 |
T |
 |
| Q |
108 |
ccacgtg-ccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||| |||||||||||||| ||||| |
|
|
| T |
17943491 |
ccacgtgaccccctaaataatatacgtg |
17943518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 17943626 - 17943514
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
17943626 |
tctttccaaaagttacggttatgaccccctaactaatttaaatacaaaatagccccctatgttttgattgtttggcagttttggacccccagttcattag |
17943527 |
T |
 |
| Q |
101 |
cgaggtgccacgt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17943526 |
tgaggtgccacgt |
17943514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 20283962 - 20283850
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
20283962 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccgagtccattag |
20283863 |
T |
 |
| Q |
101 |
cgaggtgccacgt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20283862 |
tgaggtgccacgt |
20283850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 21070590 - 21070478
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
21070590 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggaccccgagtccattag |
21070491 |
T |
 |
| Q |
101 |
cgaggtgccacgt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
21070490 |
tgaggtgccacgt |
21070478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 41206412 - 41206294
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
41206412 |
aaaagttgcggttatggccccctaactaatttaaatacaaa-cagccccctatgttttgattctttggcagttttgaacccccagtccattagtgaggtg |
41206314 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataa |
126 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
41206313 |
ccacgtggccccctaaataa |
41206294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 26 - 134
Target Start/End: Original strand, 4106919 - 4107028
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgccacgt-gccccctaaat |
124 |
Q |
| |
|
||||||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
4106919 |
cccctaactaatttaaatacaaaacagtcccctatgttttgattttttggcagttttggacccccggtccattagtgaggtgtcacgtggccccctaaat |
4107018 |
T |
 |
| Q |
125 |
aatacacgtg |
134 |
Q |
| |
|
|||||||||| |
|
|
| T |
4107019 |
aatacacgtg |
4107028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 5577587 - 5577474
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||| ||||||||| ||||||||||||||| ||||||| ||| |||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
5577587 |
tctttccaaaagttgcagttatgacctcctaactaatttaaatacaaaacggccccctatgttttgattctttggcagttttggacctccagtccattag |
5577488 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5577487 |
ggaggtgccacgtg |
5577474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 14 - 130
Target Start/End: Original strand, 7653415 - 7653532
Alignment:
| Q |
14 |
tgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgccacgt |
113 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7653415 |
tgcggttatggtaccctaactaatttaaatacaaaacagccccttatgttttgattttttggcagttttggaccctcagtccattagtgaggtgccacgt |
7653514 |
T |
 |
| Q |
114 |
-gccccctaaataataca |
130 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7653515 |
ggccccctaaataataca |
7653532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 41014836 - 41014949
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
41014836 |
tctttcaaaaagttgcggttatggccccctaactaatttaaatacaaaacagacccctatgttttgattcttttgcagttttggacccccagtccattag |
41014935 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
41014936 |
tgaggtgtcacgtg |
41014949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 3411427 - 3411524
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3411427 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
3411524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 5734472 - 5734375
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5734472 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
5734375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 8834226 - 8834129
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8834226 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattgtttggcagttttggacccccagtccatt |
8834129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 15188216 - 15188119
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15188216 |
tctttctaaaagctgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagttcatt |
15188119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20095974 - 20095877
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
20095974 |
tctttccaaaagttgcggttatgggcccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
20095877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 20791285 - 20791172
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||| ||||| |||||||||| |
|
|
| T |
20791285 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagtttttaacccctagtccattag |
20791186 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20791185 |
taaggtgccacgtg |
20791172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 29233792 - 29233695
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29233792 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
29233695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 37205828 - 37205731
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37205828 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
37205731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 39616838 - 39616730
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
39616838 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttaga-ccccagtccattag |
39616740 |
T |
 |
| Q |
101 |
cgaggtgcca |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
39616739 |
tgaggtgcca |
39616730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 40918419 - 40918532
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| |||||||| |||||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||| |||||||||||||||| |||||||| |
|
|
| T |
40918419 |
tctttttaaaagttacggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattctttgacagttttggacccccaatccattag |
40918518 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40918519 |
tgaggtgccacgtg |
40918532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42642118 - 42642215
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42642118 |
tctttctaaaagttggggttatggacccctaactaatttaaatacaaaacagcctcttatgttttgattctttggcagttttggacccccagtccatt |
42642215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42906398 - 42906495
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42906398 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgacagttttggacccccagtccatt |
42906495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 4107128 - 4107023
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||| | |||||||||||| |||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
4107128 |
aaaagttgcggttatgacccc-taactaatttaaatacaaaacagccccatatgttttgattctttggcagttttagacccccggtccattagtgaggtg |
4107030 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
4107029 |
ccacgtg |
4107023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 4146818 - 4146908
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4146818 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
4146908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 44886184 - 44886094
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44886184 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
44886094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 6107404 - 6107307
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6107404 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttcgcagttttggacccccagtccatt |
6107307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 27339569 - 27339666
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27339569 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctttggcagttttggacccccagtccatt |
27339666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 41206188 - 41206293
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || ||| |||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
41206188 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctttgttttgattctttggcagttttggacccccagaccattag |
41206287 |
T |
 |
| Q |
101 |
cgaggt |
106 |
Q |
| |
|
||||| |
|
|
| T |
41206288 |
tgaggt |
41206293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 41554874 - 41554762
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||| | ||||||||| |
|
|
| T |
41554874 |
tctttctaaaagttgcggttgtggccccctaactaatttaaatacaaaacaacc-cctatgttttgattctttggcagttttggaccctcggtccattag |
41554776 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
41554775 |
tgaggtgctacgtg |
41554762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 45209002 - 45209099
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45209002 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
45209099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 4132780 - 4132875
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
4132780 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
4132875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 32692765 - 32692892
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||| | ||||||||| | |||||||||||| ||||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
32692765 |
aaaagttacggttatagccccctaattaatttaaataaaaaacagccccttatgttttgattctttggcaattttggatccccagtccattagtaaggtg |
32692864 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
32692865 |
ccacgtggccccctaaataatacacgtg |
32692892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 7 - 98
Target Start/End: Original strand, 37277492 - 37277583
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37277492 |
taaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccaatccatt |
37277583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 39515841 - 39515746
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
39515841 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
39515746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 2321549 - 2321639
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2321549 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
2321639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 7151129 - 7151039
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7151129 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
7151039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20095712 - 20095802
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20095712 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
20095802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 23234060 - 23233970
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23234060 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagacccctatgttttgattctttggcagttttggacccccagtccatt |
23233970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29233568 - 29233658
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29233568 |
tctttccaaaagttgcggttatgtacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
29233658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 37953407 - 37953497
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37953407 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattttttggcagttttggaccccgagtccatt |
37953497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39625993 - 39626083
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
39625993 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
39626083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39635543 - 39635633
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
39635543 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
39635633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 42363859 - 42363769
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42363859 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
42363769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 45106468 - 45106558
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45106468 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
45106558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 45209263 - 45209173
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45209263 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
45209173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 45516200 - 45516110
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
45516200 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggactcccagtccatt |
45516110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 6014705 - 6014608
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
6014705 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggacccctagtccatt |
6014608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 8870548 - 8870451
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
8870548 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccagtccatt |
8870451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 30845580 - 30845677
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30845580 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagctccctatgttttgattctttggcagttttggacccccagtccatt |
30845677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 31191757 - 31191664
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
31191757 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggactcccagtc |
31191664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 35735529 - 35735626
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
35735529 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggtagttttggacccccagtccatt |
35735626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 36226702 - 36226605
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
36226702 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccctagtccatt |
36226605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 42524995 - 42524898
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
42524995 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttttgcaattttggacccccagtccatt |
42524898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 2321804 - 2321716
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
2321804 |
tctttccaaaagttgtggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
2321716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 16531529 - 16531441
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
16531529 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
16531441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 5734217 - 5734300
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5734217 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
5734300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 7653636 - 7653534
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||| || ||||||| |||||||||||||| |||||| |
|
|
| T |
7653636 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattctttgacaattttgga-ccccagtccattagtgaggtg |
7653538 |
T |
 |
| Q |
108 |
ccac |
111 |
Q |
| |
|
|||| |
|
|
| T |
7653537 |
ccac |
7653534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 25249987 - 25250070
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25249987 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
25250070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 37205573 - 37205656
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37205573 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
37205656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 995274 - 995184
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
995274 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatattttgattctttggcagttttggacccccagtccatt |
995184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 6107143 - 6107233
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6107143 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
6107233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 7013630 - 7013540
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
7013630 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccctcagtccatt |
7013540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 7150875 - 7150965
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
7150875 |
aaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtccatt |
7150965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 8870285 - 8870375
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8870285 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
8870375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 18553258 - 18553168
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18553258 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggaccccca |
18553168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 30358876 - 30358966
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
30358876 |
aaaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccctagtccatt |
30358966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 41574188 - 41574278
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41574188 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctacgttttgattctttggcagttttggacccccagtccatt |
41574278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 27872736 - 27872833
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||| |||| |||||||||| |
|
|
| T |
27872736 |
tctttctaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttagacctccagtccatt |
27872833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 86
Target Start/End: Complemental strand, 30845847 - 30845762
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
30845847 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggac |
30845762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 35409739 - 35409836
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| |||||| |||| | |||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
35409739 |
tctttccaaaagttgcggttatgaccctctaactaatttaaatacaaaagagccccatatgttttgattctttgacagttttggacccccaatccatt |
35409836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 37953653 - 37953572
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
37953653 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
37953572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 38166510 - 38166607
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||| ||||| |||||||||||||| |
|
|
| T |
38166510 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcaattttgaacccccagtccatt |
38166607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 38593213 - 38593310
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
38593213 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagccctctatgttttgattatttggcagttttggacccccaatccatt |
38593310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 39626255 - 39626158
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39626255 |
tctttccaaaagctgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttagacccccagtccatt |
39626158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 39635805 - 39635708
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39635805 |
tctttccaaaagctgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttagacccccagtccatt |
39635708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 41788677 - 41788774
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||| |||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
41788677 |
tctttttaaaagttgcagttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcaattttggacccccagtccatt |
41788774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 1657672 - 1657584
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
1657672 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
1657584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 4147071 - 4146983
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4147071 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
4146983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 14032062 - 14032150
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
14032062 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
14032150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 18531120 - 18531032
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| ||||||||||| ||||| ||||||||||||| || ||||||||||| |
|
|
| T |
18531120 |
tctttctaaaagttacggttatgaacccctaactaatttaaatacaaaacagccccctatattttgattttttgacaattttggacccc |
18531032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 42524736 - 42524824
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
42524736 |
tctttctaaaagttgcgattatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
42524824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 42267745 - 42267662
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
42267745 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgg |
42267662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 42363604 - 42363698
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42363604 |
tctttccaaaagttgctgttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggtagttttggacccccagtcca |
42363698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 414693 - 414783
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
414693 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
414783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 4133042 - 4132952
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4133042 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttaattctttggcagttttggaccccca |
4132952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 4167480 - 4167391
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
4167480 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatg-tttgattctttggcaattttggacccccagtccatt |
4167391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 6641878 - 6641788
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||| ||| |||| |||||||||||| |||||||||| |
|
|
| T |
6641878 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatgtttttattctttgacagttttggacctccagtccatt |
6641788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 6655308 - 6655390
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6655308 |
taaaagttgcggttatggacccctaactaatttagatacaaaacaacctcctatgttttgattctttggcagttttggacccc |
6655390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 6735710 - 6735792
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | |||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6735710 |
taaaagttgcggttatggacccctaactaatttagatacaaaacaacctcctatgttttgattctttggcagttttggacccc |
6735792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 6745274 - 6745184
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||| || ||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6745274 |
aaaagttgcggtaatagacccctaactaatttaaatacaaaacagctccctatgttttgattctttggcagttttggacccccagtccatt |
6745184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 8287884 - 8287794
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| |||||| | || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8287884 |
aaaagttgcggttatggacccttaactaatttaaatacaaaataaccccctatgttttgattctttggcagttttggacccccagtccatt |
8287794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 8833968 - 8834058
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| | | ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8833968 |
tctttcaaaaagttgcggttatggactcataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
8834058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 32332166 - 32332256
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
32332166 |
tctttccaaaagttgcggttttggacccctaactaatttaaaaacaaaacagccccctatgttttgattctttggcagttttggcccccca |
32332256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 36788280 - 36788370
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36788280 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacatccccctatgttttgattctttggcagttttggaccccca |
36788370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 38166773 - 38166683
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
38166773 |
tctttccaaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttagaccccca |
38166683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 42866373 - 42866267
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||| |||||| | || ||||| |||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42866373 |
aaaagttgcggttacagccccttaattaatttaaatacaaaataaccccctatattttgattctttggcagttttggacccccagtccattagtgaggtg |
42866274 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
42866273 |
ccacgtg |
42866267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 995026 - 995107
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
995026 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggacccc |
995107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 6655565 - 6655468
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||||||||| |||||||||| |||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
6655565 |
tctttccaaaagttgcggtaatggacccctaactaatttaaatacaaaacagctccctatgttttgattctttgacaattttggacccccagtccatt |
6655468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 6735967 - 6735870
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||||||||| |||||||||| |||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
6735967 |
tctttccaaaagttgcggtaatggacccctaactaatttaaatacaaaacagctccctatgttttgattctttgacaattttggacccccagtccatt |
6735870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 85
Target Start/End: Original strand, 25910311 - 25910388
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
25910311 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattttttggcagttttgga |
25910388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 35735764 - 35735699
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35735764 |
cccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggaccccca |
35735699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 41625493 - 41625578
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagt |
93 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
41625493 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagt |
41625578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 31190669 - 31190757
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
31190669 |
tctttctaaaagttgcggttatagacccctaactaatttaaatacaaaatagccccctatgttttgattctttgacagttttggacccc |
31190757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 32318793 - 32318705
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||| ||||||||||| ||||||||||||| |||||| ||||||| |||| |
|
|
| T |
32318793 |
tctttctaaaagttgcggttatgaacccttaactaatttaaatacaaaacagccctctatgttttgattctttggcggttttggccccc |
32318705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 38593470 - 38593382
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
38593470 |
tttccaaaagttgcggttattgacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
38593382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 45106722 - 45106634
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
45106722 |
tctttttaaaagttgcggttatggatccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccc |
45106634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 1985856 - 1985761
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||| |||||||| || |||||||||||||| |||| |||||||| |||||||||||| |
|
|
| T |
1985856 |
tctttccaaaagttgcggttatggacccctaattaatttaaatacaaaacaaccccctatgttttgattctttgacagttttgaacccccagtcca |
1985761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 6014452 - 6014535
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
6014452 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgtttcgattctttggcagttttggaccccca |
6014535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 6641622 - 6641713
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc-tcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
6641622 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccaccctatgttttgattctttagcagttttggaccccca |
6641713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 28 - 91
Target Start/End: Original strand, 8287656 - 8287719
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8287656 |
cctaactaatttaaatacaaaacagcctcctatgttttgattctttggcagttttggaccccca |
8287719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 20819785 - 20819868
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
20819785 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatattttgattctttggcagttttggaccccca |
20819868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 27872996 - 27872909
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
27872996 |
tctttctaaaagttgcagttatggactcctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggaccc |
27872909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 37277740 - 37277657
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37277740 |
aaaagttatggttatggacccctaactaatttaaatacaaaacaacctcctatgttttgattctttggcagttttggaccccca |
37277657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 42866185 - 42866268
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
42866185 |
aaaagttgcggttaggaccccttaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaaccccca |
42866268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 42930898 - 42930815
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| || ||| ||||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
42930898 |
aaaagttgcggttatgaatccttaattaatttaaatacaaaacagcctcctatgttttgattctttagcagttttggaccccca |
42930815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 27339830 - 27339740
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||||||||||| ||| ||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
27339830 |
tctttttaaaagttgcggttatggacccttaactaatttaaatacaaaacagacccctatgttttgattcttttgcagttttggaccccca |
27339740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 28595963 - 28596053
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
28595963 |
aaaagttgcggttatggatccttaactaatttaaatacaaaacagtcacctatgttttgattctttggcagttttggaccctcagtccatt |
28596053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 28596217 - 28596127
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
28596217 |
tctttctaaaagttgtggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcaattttggaccccca |
28596127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 30359129 - 30359039
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
30359129 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagctccctatgttttgattctttgtcagttttggatcccca |
30359039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 32693001 - 32692887
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccc-taactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||| |||| ||||||||||| ||||| ||||||||||||| | |||||| || |||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
32693001 |
tctttccaaaaattgcggttatggcccccctaactaatttaaataaaaaacaaccccctatgttttgattctttgacagttttggacccccagttcatta |
32692902 |
T |
 |
| Q |
100 |
gcgaggtgccacgtg |
114 |
Q |
| |
|
|||||||||||| |
|
|
| T |
32692901 |
ataaggtgccacgtg |
32692887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39515584 - 39515674
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
39515584 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagctccatatgttttgattctttggcagttttggcccccca |
39515674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 42642375 - 42642285
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
42642375 |
tctttccaaaggttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggtagttttggaccccca |
42642285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 42906661 - 42906571
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| |||||| |||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
42906661 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaatagccccctatgttttgattatttggcagtttttgaccccca |
42906571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 44885937 - 44886019
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
44885937 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgtttcgattctttggcagttttggaccccc |
44886019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 25250233 - 25250136
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||| |||||| ||||| ||||||||| |
|
|
| T |
25250233 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggtagttttagaccctcagtccatt |
25250136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 41574439 - 41574357
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
41574439 |
tctttctaaaagttgcgattatggacccctaactaatttaaatacaaaacagcct--tatgttttgattctttggcagttttgga |
41574357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 7013382 - 7013462
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
||||||||||||| || |||||||||| |||||| ||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
7013382 |
aaaagttgcggttttggacccctaactattttaaatacaaaacagccccctatgttttgattctttggcagttttggaccc |
7013462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 18553022 - 18553094
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
18553022 |
cccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggatccccagtccatt |
18553094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 32318532 - 32318619
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||| ||||| || || |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
32318532 |
tctttctaaaagttgcggttatgaaccc-taactaatttaaatacaaatcaaccccctatgttttgattctttggcagttttgaacccc |
32318619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 42267489 - 42267577
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
42267489 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaacccctagtcca |
42267577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 414935 - 414868
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttgg |
75 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
414935 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgg |
414868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 4167237 - 4167320
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4167237 |
aaaagttgtggttattgacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
4167320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 6335365 - 6335448
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
6335365 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggaccccca |
6335448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 33877776 - 33877693
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| | ||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
33877776 |
aaaagttgtggttatggactcctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccca |
33877693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 37639540 - 37639623
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| |||| || ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37639540 |
aaaagttgaggttttggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
37639623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 1657414 - 1657504
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1657414 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaaacagtcccctatgttttgattctttagcagttttggaccccca |
1657504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 11 - 89
Target Start/End: Original strand, 1985605 - 1985683
Alignment:
| Q |
11 |
agttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | ||||||||| |||||||||||||| |||||||||||||| |||| |
|
|
| T |
1985605 |
agttgcggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttggccccc |
1985683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 14032320 - 14032230
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
14032320 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaaacagtcccctatgttttgattctttagcagttttggaccccca |
14032230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 33881367 - 33881261
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||| ||| ||||||||| ||| || ||||||||| ||||| |
|
|
| T |
33881367 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcctctatgttttgattcttttgcagttttgaacctccggtccattagtaaggtg |
33881268 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
|||||| |
|
|
| T |
33881267 |
tcacgtg |
33881261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 36801423 - 36801509
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| | |||||||||||||| ||||||||||||||||| ||||||||| | ||||||||||||||||||| || ||||||||| |
|
|
| T |
36801423 |
tctttccacaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattttttgtcaattttggacc |
36801509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 6335608 - 6335527
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||| |||||||||| || ||||||||||| |
|
|
| T |
6335608 |
aaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttctgattttttgccaattttggacccc |
6335527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 6745042 - 6745107
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6745042 |
cccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
6745107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 15187961 - 15188042
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| |||| |||||||||||||| |
|
|
| T |
15187961 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagtcccctatgttttgattctttgacagttttggacccc |
15188042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 20813769 - 20813850
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
20813769 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagttccctatgttttgattctttggcagttttgaacccc |
20813850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20820039 - 20819944
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| |||||||| || | |||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
20820039 |
tctttccaaaagttgcggttatggaccc-taactaatttaaatacaaaacaaccccatatgttttgattctttggcagttttgga-ccccagtccatt |
20819944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 33947070 - 33947150
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||| |||||||| | ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
33947070 |
tctttccaaaagttgagattatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttt |
33947150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 45480339 - 45480259
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| || ||||||||||| |
|
|
| T |
45480339 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcccactatgttttgtttctttggcagttt |
45480259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 12330099 - 12330182
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacag-cctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| || ||||| |||||||| ||||||||||||| |
|
|
| T |
12330099 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcccccctattttttgattctttggcagttttg |
12330182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 20056437 - 20056520
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||| ||| ||||||||||||| ||||||||||||||||| ||||||||| | | |||||||||||| |||||||||||||| |
|
|
| T |
20056437 |
tctttttaatagttgcggttatggacccctaactaatttaaatacaaaacagtcccttatgttttgattctttggcagttttgg |
20056520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 23233814 - 23233897
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23233814 |
aaaagttgcggttatagatccctaactaatttaaatacaaaatggccccctatgttttgattctttggcagttttggaccccca |
23233897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 26 - 96
Target Start/End: Complemental strand, 20057241 - 20057171
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||| ||| |||||||| |
|
|
| T |
20057241 |
cccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttgaaccaccagtcca |
20057171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 41693339 - 41693249
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||| ||||||||| | ||||| |||||| | ||||||| ||||| ||||||| |
|
|
| T |
41693339 |
tctttccaaaagttgcggttatgaagccctaactaatttaaatacaaaacaggcccctatattttgaatctttggcacttttgaaccccca |
41693249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 26 - 91
Target Start/End: Complemental strand, 41625723 - 41625658
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
41625723 |
cccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggcccccca |
41625658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 27822901 - 27822977
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggca |
77 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||| |
|
|
| T |
27822901 |
tctttccaaaatttgcggttatggacccctaactaatttaaatacaaaacatccccctatgttttgattctttggca |
27822977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 10285498 - 10285431
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
10285498 |
tgaccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttggacccc |
10285431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 16531281 - 16531356
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||||| || || ||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16531281 |
aaaagttgcggttatggatcctcaattaatttaaatacaaaacagcctcctatgttttgattctttggcagttttg |
16531356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 27 - 98
Target Start/End: Original strand, 18530884 - 18530955
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||| || ||||| |
|
|
| T |
18530884 |
ccctaactaatttaaatacaaaacagccctttatgttttgattctttggcagttttggacccctagcccatt |
18530955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 28 - 91
Target Start/End: Complemental strand, 20813996 - 20813933
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||| | ||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
20813996 |
cctaactaatttaaatagaaaacagccccctatgttttgattctttggcagttttggcccccca |
20813933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 14024327 - 14024262
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
14024327 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttg |
14024262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 41788927 - 41788846
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| ||||||||||| ||||||||| ||| |||| |||||||||||||| |
|
|
| T |
41788927 |
aaaagttgcggttatggatccctaattaatttaaatacaaaacagccctctatgttttaattctttgacagttttggacccc |
41788846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 5 - 73
Target Start/End: Complemental strand, 36801651 - 36801583
Alignment:
| Q |
5 |
tctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatttttt |
73 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
36801651 |
tctaaaagttatggttatggatccctaactaatttaaatacaaaacagccccctatgttttgatttttt |
36801583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 41368669 - 41368581
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||| | || || |||||||||||||| ||| ||||||||||| ||||||| |||| | |||||||||||||| |||| |
|
|
| T |
41368669 |
tctttccaaaagttgtgattttggccccctaactaattaaaatacaaaacagccccctatgtattgaatctttggcagttttggccccc |
41368581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 31947887 - 31947962
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
31947887 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttg |
31947962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 36788539 - 36788473
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttga |
67 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
36788539 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccctctatgttttga |
36788473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 44807355 - 44807274
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
44807355 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
44807274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 7658872 - 7658796
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||| ||||| ||||||| |||| | |||||||||||||| |
|
|
| T |
7658872 |
aaaagttgcgattttggccccctaactaattaaaatacaaatcagccccctatgtattgaatctttggcagttttgg |
7658796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 18539158 - 18539246
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || |||||||| ||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
18539158 |
tctttctaaaagttgcgattttggccccctaattaattaaaatacaaaacagccccctatgtattggatctttgacagttttggccccc |
18539246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 32498695 - 32498607
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||| || || || || |||||||||||||| ||| ||||||||||| | ||||| |||| | |||||||||||||| |||| |
|
|
| T |
32498695 |
tctttctaaaatttacgattttggccccctaactaattaaaatacaaaacagccccttatgtattgaatctttggcagttttggccccc |
32498607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 83
Target Start/End: Complemental strand, 8348979 - 8348918
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||| | ||| ||||||||||||||| |
|
|
| T |
8348979 |
tgaccccctaactaattaaaatacaaaacagccccctatatattggatttttggcagttttg |
8348918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 10285128 - 10285208
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||| ||| ||||| |||| ||||||| ||| | |||||||||||| |
|
|
| T |
10285128 |
tctttctaaaagttgcgattttgaccccctaactaattaaaatgcaaaatagcc-cctatgtattggatctttggcagtttt |
10285208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 15589661 - 15589749
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||| || |||| |||||||||||| ||| |||||| ||| ||||||| || | | |||||||||||||| |||| |
|
|
| T |
15589661 |
tctttttaaaagttgcgattttgactccctaactaattaaaatacaaaatagctccctatgtattaaatctttggcagttttggccccc |
15589749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 18621747 - 18621835
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || | |||||||||||| ||| |||||||| || ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
18621747 |
tctttctaaaagttgcgattttggctccctaactaattaaaatacaaaacaaccccctatgtattggatctttgacagttttggccccc |
18621835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 27300781 - 27300717
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
27300781 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatatttggcagttttggccccc |
27300717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 83
Target Start/End: Original strand, 41368387 - 41368459
Alignment:
| Q |
11 |
agttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
41368387 |
agttgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
41368459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 5916920 - 5916861
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
5916920 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
5916861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 34608666 - 34608584
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||| ||||||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| ||||||||||||||| |
|
|
| T |
34608666 |
tctttttaaaagttgcgattttggccccctaactaattaaaatacaaaacaaccccctatgtattg-gattttggcagttttgg |
34608584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 12278887 - 12278949
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||| ||| ||||| |||||||||| |||| |
|
|
| T |
12278887 |
ccctaactaattaaaatacaaaacagccccctatgtattggatttttcgcagttttggccccc |
12278949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 84
Target Start/End: Original strand, 23936314 - 23936388
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |
|
|
| T |
23936314 |
aagttgcgattttggccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttgg |
23936388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 29454370 - 29454420
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
29454370 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaaca |
29454420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 38701923 - 38701861
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
38701923 |
ccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
38701861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 45308489 - 45308562
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||| || ||| ||||||||||||| ||| ||||||||||| ||||||| ||| | ||||| ||||||| |
|
|
| T |
45308489 |
aagttgcgattttgaacccctaactaattaaaatacaaaacagccccctatgtattggatctttggtagttttg |
45308562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 7477363 - 7477451
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||| || || ||||||||||||| ||| ||||||||||| | ||||| || | |||||||||||||| |||| |
|
|
| T |
7477363 |
tctttttaaaagttgcgattttggtcccctaactaattaaaatacaaaacagccccttatgtattagatctttggcagttttggccccc |
7477451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 84
Target Start/End: Complemental strand, 32165126 - 32165070
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||| ||| ||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
32165126 |
cctaacaaattaaaatacaaaacagcctcctatgtattggatctttggcagttttgg |
32165070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 44807121 - 44807184
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
44807121 |
ccccctaactaattaaaatacaaaacagcc-cctatgtattggatctttggcagttttggccccc |
44807184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 89
Target Start/End: Complemental strand, 45309581 - 45309521
Alignment:
| Q |
29 |
ctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
45309581 |
ctaactaattaaaatacaaaacagccccctatgtattggatatttggcagttttggccccc |
45309521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 16041 - 15908
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16041 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttgga-ccccagtccattag |
15943 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
15942 |
tgaggtgccacgtggccccctaaataatacacgtg |
15908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 15800 - 15913
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15800 |
tctttctaaaagttgcggttatggccctctaactaatttaaatacaaaacagtcccctatgttttgattttttggcagttttggacccccagtctattag |
15899 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15900 |
tgaggtgccacgtg |
15913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 22321 - 22455
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22321 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccccagtccattag |
22420 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
22421 |
tgaggtgccacgtggccccctaaataatacacgtg |
22455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 22563 - 22450
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22563 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccccagtccattag |
22464 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
22463 |
tgaggtgccacgtg |
22450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 99; Significance: 6e-49; HSPs: 233)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 27448840 - 27448974
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448840 |
tctttccaaaagttgcggttatggtcccctaactaatttaaatacaaaacagccccttatgttttgattttttggcagttttggacccccagtccattag |
27448939 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
27448940 |
tgaggtgccacgtggccccctaaataatacacgtg |
27448974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 14015423 - 14015296
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
14015423 |
aaaagttgcggttatgtccccctaactaatttaaatacaaaacagcctcctatgttttgatttcttggcagttttggaccctcggtccattagtgaggtg |
14015324 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
14015323 |
ccacgtggccccctaaataatacacgtg |
14015296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 43678982 - 43678871
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43678982 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacaaccccctatgttttgattttttggcagttttggacccccagtccattagtgaggtg |
43678883 |
T |
 |
| Q |
108 |
ccacgtgccccc |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43678882 |
ccacgtgccccc |
43678871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 12881261 - 12881395
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12881261 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
12881360 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||||| |
|
|
| T |
12881361 |
tgaggtgccacgtggccctctaaataatatacgtg |
12881395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 7858249 - 7858115
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
7858249 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagtcccctatgttttgattctttgacagttttagacccccagtccattag |
7858150 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
7858149 |
tgaggtgccacgtggccccctaaataatacacgtg |
7858115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 40082245 - 40082372
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||| |||||| |||| |||||||||| ||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
40082245 |
aaaagttgcggttatgatcccctaattaatttaaatacaaaatagccccctatgttttaattttttggcagttttggacccccagtccatcagtgaggtg |
40082344 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
40082345 |
ccacgtggccccctaaataatacacgtg |
40082372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 7858014 - 7858120
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7858014 |
aaaagttgcggctatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
7858113 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
7858114 |
ccacgtg |
7858120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 14133908 - 14133774
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||| |||||||| |||||||| || ||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
14133908 |
tctttccaaaagttgtggttatggccccctaaccaatttaaatacaaaacacccccctatgttttgtttgtttggcagttttggacccccagtccattag |
14133809 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
14133808 |
tgaggtgccacgtggccccctaaataatacacgtg |
14133774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 47423415 - 47423281
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
47423415 |
tctttccaaaagttgcggttatggtcccataattaatttaaatacaaaacagccctctatgttttgattttttggcagttttggacccccagtccatttg |
47423316 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
47423315 |
tgaggtgccacgtggccccctaaataatacacgtg |
47423281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 20982546 - 20982417
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20982546 |
tctttccaaaagttgcggttatggcccc-taactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagttcattag |
20982448 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataataca |
130 |
Q |
| |
|
||||||||| || ||||||||||||||||| |
|
|
| T |
20982447 |
tgaggtgccatgtggccccctaaataataca |
20982417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 32593823 - 32593948
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||| || ||||| |||| ||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32593823 |
aaaagttgcggttatggcccc-taactaatttaaatacaaaacaaccccctatattttaattttttggcagttttggacccccaatccattagtgaggtg |
32593921 |
T |
 |
| Q |
108 |
ccacgtgccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
32593922 |
ccacgtggcccctaaataatacacgtg |
32593948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 47423180 - 47423286
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
47423180 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggacccccagtccattagtgaggtg |
47423279 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
47423280 |
ccacgtg |
47423286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 2711727 - 2711839
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||| ||||||||||| ||||| |
|
|
| T |
2711727 |
tctttctaaaagttgcggttatgaccccctaactaatttaaatacaaaacagac-cctatgttttgattatttggcagttttagacccccagtctattag |
2711825 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2711826 |
tgaggtgccacgtg |
2711839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 14133666 - 14133779
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||| ||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
14133666 |
tctttccaaaacttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattgtttggcagttttggacccccaatccattag |
14133765 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14133766 |
tgaggtgccacgtg |
14133779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 34942770 - 34942897
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttga-ttttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||| |||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
34942770 |
aaaagttgcggttatgactccctaactaatttaaatacaaaacaaccccctatgttttgatttttttggcagttttgga-ccccagtccattagtgaggt |
34942868 |
T |
 |
| Q |
107 |
gccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |
|
|
| T |
34942869 |
gccacgtggccccctaaataaaacacgtg |
34942897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 25053636 - 25053762
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| | ||||||||| ||||| |||||| |||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
25053636 |
aaaagttgcggttatggccccctaactaatttaaatataaaacagccccctatattttga-tttttggctgttttggacccccagttcattagtgaggtg |
25053734 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
25053735 |
ccacgtggccccctaaataatacacgtg |
25053762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 39905761 - 39905864
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||| || ||| |
|
|
| T |
39905761 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtccattagtgaagtg |
39905860 |
T |
 |
| Q |
108 |
ccac |
111 |
Q |
| |
|
|||| |
|
|
| T |
39905861 |
ccac |
39905864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 42465957 - 42465825
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| ||||||| |||||||||||||||||||||| |||||||||||||||| || ||||||||| ||| |
|
|
| T |
42465957 |
tctttccaaaagttgcggttatgatcccctaactgatttaaatacaaaacagcctcctatgttttaattttttggcagttttaga--cccagtccaatag |
42465860 |
T |
 |
| Q |
101 |
cgaggtgccacgtg-ccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |
|
|
| T |
42465859 |
tgaggtgccacctgaccccctaaataatacacgtg |
42465825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 32594049 - 32593943
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
32594049 |
aaaagttgtggttatggccccctaactaatttaaatacaaaacagtctcctatgttttaattttttggcagttttggacctccagtccattagtgaggtg |
32593950 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
32593949 |
ccacgtg |
32593943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 51336923 - 51337029
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||| |||||||||| ||||| |||||| |
|
|
| T |
51336923 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaacccccagtctattagtgaggtg |
51337022 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
51337023 |
ccacgtg |
51337029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 21841753 - 21841866
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||||||| |||||||| || ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21841753 |
tctttccaaaagttgtggttatggccccctaactaatttaaatacaaaacaaccccctatattttgattctttggcagttttggacccccagtccattag |
21841852 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21841853 |
tgaggtgccacgtg |
21841866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 12881502 - 12881391
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| ||||||||| |||| |
|
|
| T |
12881502 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgga-ccccagtcctttag |
12881404 |
T |
 |
| Q |
101 |
cgaggtgccacgt |
113 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12881403 |
tgaggtgccacgt |
12881391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 21841991 - 21841861
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatt---ttttggcagttttggacccccagtccattagcgag |
104 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| | |||||||||||||| |||| ||||||||||||||||| |||||||| ||| |
|
|
| T |
21841991 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacatgcccctatgttttgattttttttttgcagttttggacccccaatccattagtgag |
21841892 |
T |
 |
| Q |
105 |
gtgccacgtg-ccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
21841891 |
gtgccacgtgaccccctaaataatacacgtg |
21841861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 111
Target Start/End: Original strand, 27719744 - 27719843
Alignment:
| Q |
13 |
ttgcggttatgaccccctaactaatttaaacacaaaacagcctcc-tatgttttgattttttggcagttttggacccccagtccattagcgaggtgccac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| || |||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27719744 |
ttgcggttatgaccccctaactaatttaaatacaaaacagcccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtgccac |
27719843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 9153764 - 9153667
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9153764 |
tctttctaaaagttacggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
9153667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 14015190 - 14015301
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||| ||| ||||||||||||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14015190 |
tctttccaaaagttgcggttatgatccc-taactaatttaaatacaaaacagcctc-tatgttttgattctttggcagttttggacccccagtccattag |
14015287 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
14015288 |
tgaggtgtcacgtg |
14015301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 19391990 - 19391893
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19391990 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
19391893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 36017048 - 36016951
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36017048 |
tctttccaaaagttgcggttatgcacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
36016951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 42230318 - 42230221
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42230318 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
42230221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 42465717 - 42465830
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| | |||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
42465717 |
tctttccaaaagttgcggttatggtcccctaactaatttaaatacaaaacaactccctatgttttgattctttggcagttttggacccccaatccattag |
42465816 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42465817 |
tgaggtgccacgtg |
42465830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 20982306 - 20982413
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
20982306 |
tctttctaaaagttgcggttatggccccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttgga-cctcagtccattag |
20982404 |
T |
 |
| Q |
101 |
cgaggtgcc |
109 |
Q |
| |
|
|||||||| |
|
|
| T |
20982405 |
tgaggtgcc |
20982413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 52613375 - 52613498
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
52613375 |
aaaagttgtggttacagccccctaactaatttaaatacaaaacagcccactatgttttaattttttggcagttttggaaccccagtccattagtgaggtg |
52613474 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|| ||| ||||||||||||||||| |
|
|
| T |
52613475 |
ccgcgtggccccctaaataataca |
52613498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 52613602 - 52613500
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
52613602 |
aaaagttgcggttatggcctcctaactaatttaaatacaaaacagcc-cctatgttttaattgtttggcagttttggacccccagtccattagtgaggtg |
52613504 |
T |
 |
| Q |
108 |
ccac |
111 |
Q |
| |
|
|||| |
|
|
| T |
52613503 |
ccac |
52613500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 787132 - 787222
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
787132 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
787222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 9630801 - 9630891
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
9630801 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtccatt |
9630891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 25053871 - 25053757
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac-ccccagtccatta |
99 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
25053871 |
tctttccaaaagttgcggttatggccccttaactaatttaaatacaaaacagccccctatgttttgattcttttacagttttggaccccccagtccatta |
25053772 |
T |
 |
| Q |
100 |
gcgaggtgccacgtg |
114 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
25053771 |
gtgaggtgccacgtg |
25053757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 26012948 - 26012843
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| ||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26012948 |
aaaagttgcggttatggcccc-taactaatttaaatacaaaacagccccctatgttttaattctttggcagttttggacccccagtccattagtgaggtt |
26012850 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
26012849 |
ccacgtg |
26012843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 33576689 - 33576599
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
33576689 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttagcagttttggacccccagtccatt |
33576599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 49859551 - 49859656
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
49859551 |
tctttctaaaagttgcggttatgattccctaactaatttaaatacaaaacagcccactatgttttgattctttggcagttttgga-ccccagtccattag |
49859649 |
T |
 |
| Q |
101 |
cgaggtg |
107 |
Q |
| |
|
|||||| |
|
|
| T |
49859650 |
tgaggtg |
49859656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 5576959 - 5577056
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5576959 |
tctttttaaaagttgcggttatgcacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
5577056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 10864141 - 10864238
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10864141 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccccagtccatt |
10864238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 94
Target Start/End: Original strand, 22202510 - 22202603
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22202510 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtc |
22202603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 26494711 - 26494808
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| | | ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26494711 |
tctttccaaaagttgcggttatggactcttaactaatttaaatacaaaacagcctcttatgttttgattttttggcagttttggacccccagtccatt |
26494808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 27766544 - 27766641
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
27766544 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccggtccatt |
27766641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27857422 - 27857325
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27857422 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattatttggcagttttggacccccagtccatt |
27857325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 30200701 - 30200604
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30200701 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
30200604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 40082477 - 40082367
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||| ||||| |||| ||||||||||||||||||||||||||| || |
|
|
| T |
40082477 |
tctttctaaaagttgcggttatgacccc-taactaatttaaatacaaaacagccccct-tgttt-gattctttggcagttttggacccccagtccatcag |
40082381 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
40082380 |
tgaggtgccacgtg |
40082367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 45743925 - 45744022
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45743925 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttggcagttttggacccccagtccatt |
45744022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 52917606 - 52917509
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52917606 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
52917509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 53422115 - 53422212
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
53422115 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccacctatgttttgattctttggcagttttggaccctcagtccatt |
53422212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 53532093 - 53531996
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53532093 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaaccgccccctatgttttgattctttggcagttttggacccccagtccatt |
53531996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 26 - 114
Target Start/End: Complemental strand, 27449057 - 27448969
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27449057 |
cccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtgccacgtg |
27448969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 27719966 - 27719845
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||||| || |||||||||||||| ||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
27719966 |
aaaagttgcggttatgtcccc-taactaatttaaatacaaaacaaccccctatgttttgattatttggcagttttgga-ccccagtctattagtgaggtg |
27719869 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|||||| ||| ||||||||||||| |
|
|
| T |
27719868 |
ccacgtggcctcctaaataataca |
27719845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 3212179 - 3212269
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3212179 |
tctttctaaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccttatgttttgattatttggtagttttggaccccca |
3212269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 19914509 - 19914599
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19914509 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
19914599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 28097704 - 28097614
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
28097704 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggacccccagtccatt |
28097614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 32458805 - 32458895
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32458805 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggaccccca |
32458895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 33621899 - 33621989
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33621899 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccagtccatt |
33621989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 37182279 - 37182189
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37182279 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
37182189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 38511937 - 38511847
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38511937 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
38511847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 41282127 - 41282041
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41282127 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgtttttttggcagttttggacccccagtc |
41282041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 45744186 - 45744096
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45744186 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
45744096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 45760513 - 45760423
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
45760513 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggacccccagtccatt |
45760423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 47943492 - 47943582
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47943492 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatcttttgattctttggcagttttggacccccagtccatt |
47943582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 3212439 - 3212342
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3212439 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccaatccatt |
3212342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 17916370 - 17916273
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||| |||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17916370 |
tctttccaaaagttgcggttatggacccctaactaagttaaatacaaaacatccccctatgttttgattctttggcagttttggacccccagtccatt |
17916273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 27748270 - 27748367
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| |||||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27748270 |
tctttccaaaagttgcggttatggatccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
27748367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 32459070 - 32458973
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
32459070 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggacccctagtccatt |
32458973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 32508206 - 32508109
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
32508206 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccgagtccatt |
32508109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 33252772 - 33252675
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
33252772 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttttgcaattttggacccccagtccatt |
33252675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 45760258 - 45760347
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
45760258 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccc |
45760347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 2118746 - 2118834
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
2118746 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
2118834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 25782681 - 25782769
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25782681 |
tttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
25782769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 31869223 - 31869311
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
31869223 |
tttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggaccccca |
31869311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 51843089 - 51843001
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
51843089 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccc |
51843001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 17483838 - 17483747
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
17483838 |
aaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagttcatta |
17483747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 28964441 - 28964346
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
28964441 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
28964346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 257471 - 257549
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
257471 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggac |
257549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 2205563 - 2205653
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2205563 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccttctatgttttgattctttggcagttttggaccccca |
2205653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 2239517 - 2239427
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2239517 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttttgcagttttggaccccca |
2239427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 26012718 - 26012848
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttt----tggcagttttggacccccagtccattagcga |
103 |
Q |
| |
|
||||||| ||| |||| |||||||||||||||||| |||||||| || ||| ||||||||||||| ||||||||||||| ||| |||||||||| || |
|
|
| T |
26012718 |
aaaagttacggctatggccccctaactaatttaaatacaaaacaaccccctttgttttgattttttggctggcagttttgga-cccaagtccattagtga |
26012816 |
T |
 |
| Q |
104 |
ggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
26012817 |
ggtgccacgtggccccctaaataatacacgtg |
26012848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 28964179 - 28964261
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28964179 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttggcagttttg |
28964261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 29168762 - 29168851
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
29168762 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggacccccaatccatt |
29168851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 94
Target Start/End: Original strand, 31117653 - 31117739
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
31117653 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtc |
31117739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 33576433 - 33576523
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
33576433 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
33576523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 41281871 - 41281961
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41281871 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
41281961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 42230059 - 42230149
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42230059 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
42230149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 47530627 - 47530537
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47530627 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacggccccctatgttttgattctttggcagttttggaccccca |
47530537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 12 - 98
Target Start/End: Complemental strand, 50033517 - 50033431
Alignment:
| Q |
12 |
gttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
50033517 |
gttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccggtccatt |
50033431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 51842834 - 51842924
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
51842834 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccctcagtccatt |
51842924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 52916885 - 52916975
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52916885 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagacccctatgttttgattctttggcagttttggaccccca |
52916975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 10439560 - 10439479
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10439560 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaacctcctatgttttgattctttggcagttttggacccc |
10439479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 19391664 - 19391753
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||| |
|
|
| T |
19391664 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattatttggcagttttggaccccc |
19391753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 27984419 - 27984323
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| |||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27984419 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagcccccta-gttttaattttttggcagttttggacccccagtccatt |
27984323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 31869482 - 31869385
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||| | ||||||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31869482 |
tctttccaaaagttgcggttttggacccctaactaatttatatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
31869385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 44183998 - 44184094
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44183998 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttga-tttttggcagttttggacccccaatccatt |
44184094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 44895675 - 44895772
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||||||||| ||| ||||||| | |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44895675 |
tctttttaaaagttgcgattatggacccctaactaatttaaatacagaacagccccttatgttttgattctttggcagttttggacccccagtccatt |
44895772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 47530365 - 47530462
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| | |||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
47530365 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaacccctatgttttgattctttggcagttttagacccccagtccatt |
47530462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 53192400 - 53192303
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53192400 |
tctttccaaaagttgcggttatggacctctaactaatttaaattcaaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
53192303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 10864406 - 10864318
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10864406 |
tctttccaaaagttgcagttatgaacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccc |
10864318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 21690156 - 21690068
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
21690156 |
tctttccaaaagttacggttatgggcccctaactaatttaaatacaaaacagccccctatgttttgatttttttgcagttttggacccc |
21690068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 44177314 - 44177402
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
44177314 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
44177402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 2239260 - 2239343
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
2239260 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattgtttggaagttttggaccccca |
2239343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 8727946 - 8728029
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8727946 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
8728029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 9079833 - 9079916
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9079833 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
9079916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 7 - 98
Target Start/End: Original strand, 10439318 - 10439409
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10439318 |
taaaagttgtggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattcattggcagttttggacccccagtccatt |
10439409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 21689956 - 21690062
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || | |||||||||||| |||| |||||||||| ||||| |||||||| |
|
|
| T |
21689956 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccttatgttttgattctttgacagttttgga-ccccaatccattag |
21690054 |
T |
 |
| Q |
101 |
cgaggtgc |
108 |
Q |
| |
|
||||||| |
|
|
| T |
21690055 |
tgaggtgc |
21690062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 28097450 - 28097533
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
28097450 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggaccccca |
28097533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 31577445 - 31577540
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||| ||||| ||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
31577445 |
tctttttaaaaattgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaacccccagtcca |
31577540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 33622146 - 33622063
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33622146 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggaccccca |
33622063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 38511692 - 38511775
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38511692 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
38511775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 44895935 - 44895848
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
44895935 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccc |
44895848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 47943740 - 47943657
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
47943740 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatcttttgattctttggcagttttggaccccca |
47943657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 8315361 - 8315271
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||| ||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
8315361 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacagtctcctctgttttgattctttggcagtattggacccccagtccatt |
8315271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 9588394 - 9588308
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtc |
94 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9588394 |
aaaagttgcatttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtc |
9588308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 27748530 - 27748444
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
27748530 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggacc |
27748444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 27766804 - 27766718
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
27766804 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggtagttttggacc |
27766718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 30200442 - 30200532
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| | ||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
30200442 |
tctttccaaaagttgcggttatggacccctaactaatttaaatataaaacagccccatatgttttgattctttggcagttttggaccccca |
30200532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 32204874 - 32204964
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
32204874 |
tctttccaaaagttgcgcttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggaccccca |
32204964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 33933655 - 33933565
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
33933655 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattttttagcagttttggactccca |
33933565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 37182030 - 37182120
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| |||||| |||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37182030 |
tctttccaaaagttgcggttatggacccctaactattttaaatacaaaacagctccctatgttttgattctttggcagttttggaccccca |
37182120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 44184258 - 44184168
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
44184258 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtctcctatgtttttattctttagcagttttggaccccca |
44184168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 53191250 - 53191160
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
53191250 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
53191160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 257723 - 257626
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| | |||||| |
|
|
| T |
257723 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccctaatccatt |
257626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 25782940 - 25782843
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| | |||||||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
25782940 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaactccctatgttttgattctttagcagttttggatccccagtccatt |
25782843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 34943003 - 34942892
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| || ||||| | ||||| |
|
|
| T |
34943003 |
tctttttaaaagttgtggttatggtcccctaactaatttaaatacaaaacag-ctcctatgttttgattttttggcagtttt-gaaccccaattaattag |
34942906 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34942905 |
tgaggtgccacgtg |
34942892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 36373825 - 36373744
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
36373825 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
36373744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 51214446 - 51214349
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| | |||||| || | ||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51214446 |
tctttttaaaagttgcggttatggacccctaactaatttagatacaaaagagacccctatcttttgattctttggcagttttggacccccagtccatt |
51214349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 33933418 - 33933490
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33933418 |
cccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccccagtccatt |
33933490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 44624506 - 44624418
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44624506 |
aaaagttacggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattttttggcagttttgaacccctagtcca |
44624418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 29169008 - 29168925
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
29169008 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctgtgttttgattctttggcagttttgaaccccca |
29168925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 47360513 - 47360421
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
47360513 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagc--cctatgttttgattctttagcaattttggacccccagtcc |
47360421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 51213340 - 51213423
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51213340 |
aaaagttgcgattatggaccccaaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
51213423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 9 - 96
Target Start/End: Original strand, 51860367 - 51860454
Alignment:
| Q |
9 |
aaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
51860367 |
aaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaaccctcagtcca |
51860454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 53531839 - 53531922
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
53531839 |
aaaagttgcggttaaggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
53531922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 5577220 - 5577130
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||| ||||||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
5577220 |
tctttccaaaagttgaggttatggacccctaattaatttaaatacaaaacagccccctattttttgattctttggcagttttggaccccca |
5577130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 19914759 - 19914673
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||| | ||||||||||||||| |
|
|
| T |
19914759 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgttttgattctatggcagttttggacc |
19914673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 24393717 - 24393806
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
24393717 |
tctttttaaaagttgtggttatggacccctaactaatttaaatacaaaacagcc-catatgttttgattctttggcagttttggaccccca |
24393806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 33252510 - 33252600
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |||||||| | | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
33252510 |
tctttctaaaagttgcgattatggacccctaactaatttaaatacaaaacatctccttatgttttgattctttggcagttttggaccccca |
33252600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 41223800 - 41223710
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
41223800 |
tctttttaaaagttgtggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttagcagttttggaccccca |
41223710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 53422364 - 53422274
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||| ||| |||||||||||| ||| | ||||||||||||||| |
|
|
| T |
53422364 |
tctttctaaaagttgcggttatggatccctaactaatttaaatacaaaacagtctcttatgttttgattctttagtagttttggaccccca |
53422274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 2205815 - 2205719
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||| |||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
2205815 |
tctttccaaaaattgcggttatagactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgga-ccccagtccatt |
2205719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 92
Target Start/End: Complemental strand, 5154066 - 5153977
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccag |
92 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||| |||||||| |||||||| |
|
|
| T |
5154066 |
tttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttgaacccccag |
5153977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 95
Target Start/End: Complemental strand, 8728173 - 8728104
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8728173 |
cccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtcc |
8728104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 95
Target Start/End: Complemental strand, 9080060 - 9079991
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
9080060 |
cccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccccagtcc |
9079991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 17916132 - 17916197
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
17916132 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
17916197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 85
Target Start/End: Complemental strand, 25126278 - 25126201
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||| ||||||| |
|
|
| T |
25126278 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcaattttgga |
25126201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 53190987 - 53191084
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| | |||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| || |||||| |
|
|
| T |
53190987 |
tctttccaaaagttgcggttatggaacactaaataatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccacaatccatt |
53191084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 3 - 91
Target Start/End: Original strand, 49997683 - 49997771
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
49997683 |
tttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccatatgttttgattatttggcagttttggcccccca |
49997771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 2118994 - 2118911
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||| |||||| |
|
|
| T |
2118994 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggcccccca |
2118911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 17483594 - 17483677
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| || ||||||||||||||||| |
|
|
| T |
17483594 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttaagcagttttggaccccca |
17483677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 22202763 - 22202680
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22202763 |
aaaagttacggttatggatccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggaccccca |
22202680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 24393972 - 24393889
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
24393972 |
aaaagttgtggttatggacccttaactaatttaaatacaaaacagccccctatgttttgactctttggcagttttggaccccca |
24393889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 32507960 - 32508043
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
32507960 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacagcccgttatgttttgattctttggcagttttggaccccca |
32508043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 75
Target Start/End: Complemental strand, 49859731 - 49859664
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttgg |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
49859731 |
aaaagttgcggttatgatcccctaactaatttaaatacaaaacagccccctatgttttgattctttgg |
49859664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 5153807 - 5153896
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| |||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
5153807 |
tctttttaaaagttacggttatggacccctaactaatttaaatacaaaacagcc-cctatgttttgattctttgacagttttggcccccca |
5153896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 9633685 - 9633595
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||||| |||||||||||||||| |||| |
|
|
| T |
9633685 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagtcctttatgttttgattctttggcagttttggacaccca |
9633595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 9793199 - 9793109
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||| ||||||||||| | |||||||||||| ||||||| |||||||||| ||||||||| |
|
|
| T |
9793199 |
aaaaattgcggttatggacccataactaatttaaatacaaaacagccccttatgttttgattctttggcatttttggaccctcagtccatt |
9793109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 44177572 - 44177482
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
44177572 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaaacagtcccctatgttttgattctttagcagttttggaccccca |
44177482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 53192140 - 53192222
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||||||||||| |||||| |||||||||| ||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
53192140 |
tctttccaaaagttgcggttatggacccctatctaatttaaatacaaaacagccccctatgttttgattctttgacagttttg |
53192222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 7818959 - 7819056
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||| |||||| || | |||| |||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
7818959 |
tctttctaaaagttgcggttatggactcctaactaatttaaatacaaaatagtcatctatattttgattctttggcagttttggatccccggtccatt |
7819056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 51860615 - 51860526
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
||||| ||||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||| ||| ||| |||||||||| ||||| |
|
|
| T |
51860615 |
tctttttaaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttaattctttagcagttttggtccccc |
51860526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 27 - 91
Target Start/End: Original strand, 27857189 - 27857253
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27857189 |
ccctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggaccccca |
27857253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 31117906 - 31117826
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
||||| ||||| ||| ||||||| ||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
31117906 |
tctttttaaaaattgtggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgtttctttggcagttt |
31117826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 3 - 86
Target Start/End: Complemental strand, 787385 - 787302
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| |||| ||||||||||| |
|
|
| T |
787385 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcccattatgttttgattctttgacagttttggac |
787302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 9153510 - 9153593
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||| | | | ||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9153510 |
aaaagttgcggttaaggacacataaataatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
9153593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 31577707 - 31577624
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||| ||||||||| ||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||| ||||||| |
|
|
| T |
31577707 |
tctttttaaaagttgtggttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggccgttttgg |
31577624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 49997936 - 49997853
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| ||||| ||||||| |||||| ||||| ||||||| ||||||| |
|
|
| T |
49997936 |
aaaagttgcggttatggacccctaactaatttaaatacaaatcagccccctatgtattgattctttggtagttttgaaccccca |
49997853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 24636621 - 24636531
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| |||||||| || ||||| |||| ||| ||||||| ||||||||||| |||||||| |
|
|
| T |
24636621 |
aaaagttgcggttatggacccttaactaatttaaatacaaaacaaccccctatattttaattctttggcacttttggaccccaagtccatt |
24636531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 32205127 - 32205037
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||| ||||| ||||||||| ||| ||||||||||||||||||| ||| |||| |
|
|
| T |
32205127 |
aaaagttgcggttatggacctctaactaatttaaatacaaatcagccccctatgtttatattctttggcagttttggaccccgagttcatt |
32205037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 41223546 - 41223635
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
41223546 |
aaaagttgcggttatagacccctaactaatttaaatacaaaacagccctttatgttttgattctttggtagttttgga-ccccagtccatt |
41223635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 47722175 - 47722257
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| ||||| |||||||| ||||||| ||||| |
|
|
| T |
47722175 |
tctttccaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatattttgattatttggcaattttg |
47722257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 41722264 - 41722183
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||| ||||| ||||| |||||||||||||| ||||| ||||||||||||| |
|
|
| T |
41722264 |
aaaagttgtggttatggacccttaactaatttaaatacaaatcagccccctatgttttgattctttggtagttttggacccc |
41722183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 11963011 - 11962915
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||| ||||||||| | ||||||||| |||| |||| ||||||||||||| || ||||| |
|
|
| T |
11963011 |
ctttccaaaagttgcggttacggacccctaactaatttaaatacaaaacagacccctatgtttggattctttgttagttttggaccccaagaccatt |
11962915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 47722430 - 47722354
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||||| | | ||||||||||||| ||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
47722430 |
aaaagttgcggttatggactcataactaatttaaatacaaaacagccccctatattttgattctttggcagttttgg |
47722354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 9792954 - 9793029
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||||| ||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
9792954 |
aaaagttgcggttatagacccttaattaatttaaatacaaaacagtctcctatgttttgattctttggcagttttg |
9793029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 11961898 - 11961988
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||||| | ||||||||| ||| |||| |||||||||||||||| ||||| |
|
|
| T |
11961898 |
aaaagttgcggttacggacccctaactaatttaaatacaaaacagacccctatgtttgaattctttgttagttttggacccccagaccatt |
11961988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 66
Target Start/End: Complemental strand, 36567155 - 36567097
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||| | ||||||||||| |
|
|
| T |
36567155 |
aaaagttgcggttatggccccctaactaatttaaatacaaaacagacccctatgttttg |
36567097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 44624251 - 44624341
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| |||| ||| ||||||||| | |||||||||||||| ||||||||| | ||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
44624251 |
tctttgtaaatgttacggttatgaatctctaactaatttaaatacaaaacagtcccctctgttttgattctttggcagttttggcccccca |
44624341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 46934275 - 46934187
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||| ||| ||||||||||| | ||||| ||| | |||||||||||||| |||| |
|
|
| T |
46934275 |
tctttccaaaagttgcgattatggccccctaactaattaaaatacaaaacagccccatatgtattggatctttggcagttttggccccc |
46934187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 48160516 - 48160592
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| |||||||| || ||||||||||||| |||||||||||||| |
|
|
| T |
48160516 |
aaaagttgcggttatggatccctaattaatttaaatacaaaacaaccctctatgttttgattctttggcagttttgg |
48160592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 24636383 - 24636466
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| ||||||| | || |||| ||||||| |||||||||| || |||||||||||| |||| |||||||||||||||| |
|
|
| T |
24636383 |
aaaagttgtggttatggactccaaacttatttaaatacaaaacagcttcttatgttttgattctttgacagttttggaccccca |
24636466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 54477276 - 54477209
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
54477276 |
tgaccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttggccccc |
54477209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 56 - 98
Target Start/End: Original strand, 30760912 - 30760954
Alignment:
| Q |
56 |
cctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30760912 |
cctatgttttgattctttggcagttttggacccccagtccatt |
30760954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 2 - 91
Target Start/End: Original strand, 36566900 - 36566989
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||| ||||||| |||||||| ||| |||||||||||||| ||||||||| | ||||||||||| ||| |||||||||| |||||| |
|
|
| T |
36566900 |
ctttccaaaagtttcggttatggcccgctaactaatttaaatacaaaacagacccctatgttttgcaactttagcagttttggcccccca |
36566989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 28 - 88
Target Start/End: Original strand, 8315134 - 8315194
Alignment:
| Q |
28 |
cctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
||||||||||||||| |||||||| || | |||||||||||| ||||||| |||||||||| |
|
|
| T |
8315134 |
cctaactaatttaaatacaaaacatccccttatgttttgattctttggcaattttggaccc |
8315194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 46984932 - 46984996
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| |||||||||||||||| |||| |
|
|
| T |
46984932 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatttttggcagttttggccccc |
46984996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 54476078 - 54476150
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||| || ||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
54476078 |
aagttgcgattttgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
54476150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 26 - 84
Target Start/End: Complemental strand, 10732410 - 10732352
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
10732410 |
cccctaactaattaaaatacaaaacagccccctatgtattggatttttggcagttttgg |
10732352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 30761080 - 30761034
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
30761080 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagcc |
30761034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 3 - 53
Target Start/End: Original strand, 41722082 - 41722132
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagc |
53 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
41722082 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagc |
41722132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 44702147 - 44702066
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| | || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
44702147 |
aaaagttgtgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
44702066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 46984855 - 46984936
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| || | ||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
46984855 |
aaaagttgcggttttggacacctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
46984936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 9169288 - 9169200
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| || || | |||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
9169288 |
tctttccaaaagttgcaattttggctccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
9169200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 17256618 - 17256682
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
17256618 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
17256682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 27984165 - 27984233
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatt |
69 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
27984165 |
tctttttaaaagttgcggttatggattcctaactaatttaaatacaaaacaaccctctatgttttgatt |
27984233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 35495152 - 35495088
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||||||| |||| | |||||||||||||| |||| |
|
|
| T |
35495152 |
ccccctaactaattaaaatacaaaacagctccctatgtattgaatctttggcagttttggccccc |
35495088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 36441508 - 36441560
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagc |
53 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||| |||||||||| |
|
|
| T |
36441508 |
tctttctaaaagttgcggttatggactcctaattaatttaaatacaaaacagc |
36441560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 82
Target Start/End: Original strand, 42996461 - 42996517
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||||||| | |||||||||||| |
|
|
| T |
42996461 |
cccctaactaattaaaatacaaaacagccccctatgttttggatctttggcagtttt |
42996517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 47284579 - 47284491
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||| |||||| |||| |
|
|
| T |
47284579 |
tctttttaaaagttgcgattttggtcccctaactaattaaaatacaaaacagccccctatgtattggatctttggcaattttggccccc |
47284491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 49001688 - 49001764
Alignment:
| Q |
13 |
ttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| || ||||| ||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
49001688 |
ttgcgattttgacctcctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
49001764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 54716509 - 54716585
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||| | || ||||||||||||||||| ||| ||||||||||| ||||||| ||| | ||||| |||||||| |
|
|
| T |
54716509 |
aaaagttgtgattttgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttggtagttttgg |
54716585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Original strand, 5635398 - 5635457
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
5635398 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
5635457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 9169003 - 9169085
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||| || | ||||||||||||||| ||| |||||||| || ||||||| ||| | |||||||| |||||||||||| |
|
|
| T |
9169003 |
aaaagttgcgattttaaccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcag-tttggaccccca |
9169085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 14770705 - 14770622
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| | || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||| ||||||| |
|
|
| T |
14770705 |
tctttccaaaagttgcgatcttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggccgttttgg |
14770622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 33943585 - 33943648
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
33943585 |
cccctaactaattaaaatacaaaacagccccctatgtgttggatctttggcagttttggccccc |
33943648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 49002705 - 49002646
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||||||||| ||| | |||||||||||||| |
|
|
| T |
49002705 |
ccccttaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttgg |
49002646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 51224961 - 51225040
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| ||||||||||| |||| || ||| | |||||||||||||| |||| |
|
|
| T |
51224961 |
aagttgcgattttggccccctaactaattaaaatacaaaacagccccctacgtattggatctttggcagttttggccccc |
51225040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 83
Target Start/End: Original strand, 29918173 - 29918231
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||| | ||||||| ||||| |
|
|
| T |
29918173 |
ccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcaattttg |
29918231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 83
Target Start/End: Original strand, 29967326 - 29967384
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||| | ||||||| ||||| |
|
|
| T |
29967326 |
ccccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcaattttg |
29967384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 35495210 - 35495148
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
35495210 |
ccctaactaattaaaatacaaaacagccccctatgtattgtatctttggcagttttggccccc |
35495148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 45125396 - 45125342
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||||||| || ||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
45125396 |
aaaagttgcgattttgaccccctaactaattaaaatacaaaacagctccctatgt |
45125342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 25 - 83
Target Start/End: Complemental strand, 49876260 - 49876202
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
49876260 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
49876202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 84
Target Start/End: Original strand, 51453576 - 51453650
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||| || ||||||||||||||| | || ||||||| |||||||| || |||| ||||| |||||||||| |
|
|
| T |
51453576 |
aagttgcgattttgaccccctaactaaataaactacaaaaccgcctcctaagtattgacttttttgcagttttgg |
51453650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 53568326 - 53568408
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||| || || ||| |||||||||| ||| ||||||||| | ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
53568326 |
taaaagttgcgattttggccctctaactaattaaaatacaaaacagtcccctatgtattggatctttggcagttttggccccc |
53568408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 3384275 - 3384222
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||| |||||||||||||||| || |||| ||||||||| ||||||||||| |
|
|
| T |
3384275 |
tctttccaaaagttgcggttatggacctctaattaatttaaatacaaaacagcc |
3384222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 5049627 - 5049547
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || || ||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
5049627 |
aaaagttgcgattttggcctcctaactaattaaaatacaaaacagcc-cctatgtattggatctttggcagttttggccccc |
5049547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 91
Target Start/End: Original strand, 36016842 - 36016875
Alignment:
| Q |
58 |
tatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
36016842 |
tatgttttgattttttggcagttctggaccccca |
36016875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Complemental strand, 40989602 - 40989545
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
40989602 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
40989545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 76
Target Start/End: Original strand, 47922158 - 47922231
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggc |
76 |
Q |
| |
|
||||||||||||| | || || |||| ||||||||| ||| |||||||| |||||||||| |||| | |||||| |
|
|
| T |
47922158 |
tttctaaaagttgtgattttggccccttaactaattaaaatacaaaacaacctcctatgtattgaatctttggc |
47922231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 51187975 - 51187915
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
||||| ||||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
51187975 |
tctttttaaaagttgcgattttg-ccccctaactaattaaaatacaaaacagccccctatgt |
51187915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 82
Target Start/End: Complemental strand, 55094583 - 55094526
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
55094583 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
55094526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 1589100 - 1589175
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || ||||||| ||| ||||| ||| ||||||||||||||||||| ||| | |||||| ||||||| |
|
|
| T |
1589100 |
aaaagttgcgattttgacccc-taattaattaaaatacaaaacagcctcctatgtattggatctttggctgttttgg |
1589175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 83
Target Start/End: Complemental strand, 14004099 - 14004039
Alignment:
| Q |
23 |
gaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||||| ||| |||||||| || ||||||||||| | |||| |||||||| |
|
|
| T |
14004099 |
gaccccctaactaattaaaatacaaaacaaccccctatgttttggatctttgacagttttg |
14004039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 17258074 - 17258010
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||| ||| | |||||||||||||| |||| |
|
|
| T |
17258074 |
ccccctaactaattaaaatacaaaacagccctctatgtattggatctttggcagttttggccccc |
17258010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 98
Target Start/End: Complemental strand, 19391857 - 19391825
Alignment:
| Q |
66 |
gattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
19391857 |
gattctttggcagttttggacccccagtccatt |
19391825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 33445889 - 33445953
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
33445889 |
ccccttaactaattaaaatacaaaacagccccctatgtattgggtctttggcagttttggccccc |
33445953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 89
Target Start/End: Original strand, 35494108 - 35494175
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgt-tttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| ||||||| ||||| | |||||||||||||| |||| |
|
|
| T |
35494108 |
tgaccccctaattaattaaaatacaaaacagccccctatgtatttga-tctttggcagttttggccccc |
35494175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 36315901 - 36315965
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||| ||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
36315901 |
ccccctaactaattaaaatacaaaactgccccctatgtattggatatttggcagttttggccccc |
36315965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 46934072 - 46934148
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || | |||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |
|
|
| T |
46934072 |
aaaagttgcgattttagccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttgg |
46934148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 51225036 - 51225100
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||| | ||| | |||||||||||||| |||| |
|
|
| T |
51225036 |
ccccctaactaattaaaatacaaaacagccccctatttattggatctttggcagttttggccccc |
51225100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 53764601 - 53764688
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| || | | ||||||||||||| ||| ||||||||||| ||||||| || | |||||||||||||| |||| |
|
|
| T |
53764601 |
tctttccaaaagttgcgatttt-agcccctaactaattaaaatacaaaacagccccctatgtattagatctttggcagttttggccccc |
53764688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 82
Target Start/End: Complemental strand, 55228069 - 55228013
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||| |
|
|
| T |
55228069 |
cccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagtttt |
55228013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 99; Significance: 6e-49; HSPs: 159)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 17799116 - 17798982
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17799116 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgtttcgattttttggcagttttggacccccagtccattag |
17799017 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |
|
|
| T |
17799016 |
tgaggtgtcacgtggccccctaaataatacacgtg |
17798982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 40445599 - 40445729
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40445599 |
tctttccaaacgttgcggttatgaccccctaactaatttaaatacaaaacagctccctatgttttgattttttggcagttttggacccccagtccattag |
40445698 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
40445699 |
tgaggtgccacgtggccccctaaataataca |
40445729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 3263061 - 3263191
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||| ||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3263061 |
tctttctaaaagttgcggttatggcctcntaactaaattaaatacaaaacagccccctatgttttgatttttttgcagttttggacccccagtccattag |
3263160 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
3263161 |
tgaggtgccacgtggccccctaaataataca |
3263191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 9715136 - 9715002
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||||||||||| |||||||| || | ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9715136 |
tctttccaaaagttgcggtcatggccccctaactaatttaaatacaaaacaaccccatatgttttgattttttggcagttttggaccctcagtccattag |
9715037 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
9715036 |
tgaggtgccacgtggccccctaaataatacacgtg |
9715002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 8 - 114
Target Start/End: Complemental strand, 19368773 - 19368667
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19368773 |
aaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattagtgaggtg |
19368674 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
19368673 |
ccacgtg |
19368667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 17798874 - 17798987
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| | |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17798874 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccccagtccattag |
17798973 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17798974 |
tgaggtgccacgtg |
17798987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 3 - 134
Target Start/End: Original strand, 23000555 - 23000688
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttga-ttttttggcagttttggacccccagtccattagc |
101 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||| |||||||| || |||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
23000555 |
tttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattttttttgtagttttggacccccagtccattagt |
23000654 |
T |
 |
| Q |
102 |
gaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
23000655 |
gaggtgccacgtggccccctaaataatacacgtg |
23000688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 23000796 - 23000683
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
23000796 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccggtccattag |
23000697 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
23000696 |
tgaggtgccacgtg |
23000683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 24365157 - 24365044
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||| || |||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
24365157 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaacaaccccctatgttttgattctttgacagttttggacccccagtccattag |
24365058 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
24365057 |
tgaggtgccacgtg |
24365044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 34850944 - 34850831
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34850944 |
tctttccaaaagttgcagttatggccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
34850845 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
34850844 |
tgaggtgccacgtg |
34850831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 315044 - 315182
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac-----ccccagtcc |
95 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
315044 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccaccccagtcc |
315143 |
T |
 |
| Q |
96 |
attagcgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||| || ||||||||| ||||||||||||||||||||| |
|
|
| T |
315144 |
attagtga-gtgccacgtggccccctaaataatacacgtg |
315182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 3263303 - 3263193
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||| ||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
3263303 |
tctttctaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttgtgattatttgacagttttggacccccagtccattag |
3263204 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
3263203 |
tgaggtgccac |
3263193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 26717428 - 26717298
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| | | |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26717428 |
tctttccaaaagttgcggttatggccccctaactaatttaaatgcaaaacagtcccttatgttttgatttttttgcagttttggacccccagtccattag |
26717329 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataataca |
130 |
Q |
| |
|
||||||||| || ||||||||||||||||| |
|
|
| T |
26717328 |
tgaggtgccatgtggccccctaaataataca |
26717298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 40506229 - 40506359
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||| ||||| ||| | |
|
|
| T |
40506229 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgaatttttggcagttttggaccctcagtctattgg |
40506328 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataataca |
130 |
Q |
| |
|
||||||||| || ||||||||||||||||| |
|
|
| T |
40506329 |
tgaggtgccatgtggccccctaaataataca |
40506359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 5036535 - 5036648
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
5036535 |
tctttttaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccacagtccattag |
5036634 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
5036635 |
tgaggtgccacgtg |
5036648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 9714894 - 9715007
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| ||||||||||| |||| || ||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9714894 |
tctttccaaaagttgcggctatggcctcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccattag |
9714993 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9714994 |
tgaggtgccacgtg |
9715007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 30218993 - 30218880
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||| |||||||||| ||||| |
|
|
| T |
30218993 |
tctttctaaaagttgcggttatgaccccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttgaacccccagtctattag |
30218894 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
30218893 |
tgaggtgtcacgtg |
30218880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 40506471 - 40506361
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||| ||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40506471 |
tctttctaaaagttgcggttacggccccctaactaatttaaatacaaaacagccccctatggtttgattctttggcagttttggacccccagtccattag |
40506372 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
||||| |||| |
|
|
| T |
40506371 |
tgaggtaccac |
40506361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 315290 - 315177
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||||||||| ||||||||||| |||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
315290 |
tctttctaaaagttgcggttatggctccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacacccagtccattat |
315191 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
315190 |
tgaggtgccacgtg |
315177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 2937076 - 2936979
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2937076 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagctccctatgttttgattttttggcagttttggacccccagtccatt |
2936979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 8 - 134
Target Start/End: Complemental strand, 8739109 - 8738982
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| |||||||| | | |||||||||||||||||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
8739109 |
aaaagttgcggttatgacctcctaaccaatttaaatacaaaacaactccttatgttttgattttttggcaattttggacccccagtctattagtgaggtg |
8739010 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||| ||||||||||||||| |
|
|
| T |
8739009 |
ccacgtggccccttaaataatacacgtg |
8738982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 40445840 - 40445731
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
||||||||||||||| ||||| | ||||| |||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40445840 |
tctttctaaaagttgtggttacgcccccc-aactaatttaaatacaaaaaagccccctatgttttgattttttggcagttttggacccccagtccattag |
40445742 |
T |
 |
| Q |
101 |
cgaggtgccac |
111 |
Q |
| |
|
|||||||||| |
|
|
| T |
40445741 |
tgaggtgccac |
40445731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 19473302 - 19473189
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||| | ||||||| | |||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
19473302 |
tctttccaaaagttgcggttatggccctctaactaatttaaatataaaacagtcccctatgttttgattctttggcatttttggacccccagtccattag |
19473203 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19473202 |
tgaggtgccacgtg |
19473189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 34123267 - 34123364
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34123267 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattgtttggcagttttggacccccagtccatt |
34123364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 36987700 - 36987603
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36987700 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggacccccagtccatt |
36987603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 39431456 - 39431359
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39431456 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
39431359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42445398 - 42445495
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42445398 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgtcagttttggacccccagtccatt |
42445495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 3 - 134
Target Start/End: Original strand, 34850705 - 34850836
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcg |
102 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||||||| |||||||| | | |||||||||||||||| | ||||||||| |||||||||||||| | |
|
|
| T |
34850705 |
tttccaaaagttgcggttatggctccctaactaatttaaatacaaaacaatcccttatgttttgatttttttgtagttttgga-ccccagtccattagtg |
34850803 |
T |
 |
| Q |
103 |
aggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
34850804 |
aggtgccacgtggccccctaaataatacacgtg |
34850836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 36589992 - 36589869
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| | || ||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||| | ||||||||| |||||| |
|
|
| T |
36589992 |
aaaagttgcggttatggctccataactaatttaaatacaaaacagccttatatgttttgattctttggcagttttggaccctctgtccattagtgaggtg |
36589893 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataataca |
130 |
Q |
| |
|
|||||| ||||| ||||||||||| |
|
|
| T |
36589892 |
ccacgtggccccttaaataataca |
36589869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 21843467 - 21843377
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21843467 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
21843377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 22194481 - 22194571
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22194481 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattttttggcagttttggacccccagtccatt |
22194571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 13732454 - 13732357
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
13732454 |
tctttctaaaagttgcggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcaattttggacccccagtccatt |
13732357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 19026104 - 19026007
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19026104 |
tctttccaaaagttgcggttatagacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
19026007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 40493672 - 40493769
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
40493672 |
tctttttaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgaatctttggcagttttggacccccagtccatt |
40493769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 1381008 - 1380905
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||| ||||||| || ||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
1381008 |
aaaagttgtggttatggcctcctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccctcagtccattagtgaggtg |
1380909 |
T |
 |
| Q |
108 |
ccac |
111 |
Q |
| |
|
|||| |
|
|
| T |
1380908 |
ccac |
1380905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 1375373 - 1375283
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1375373 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttggaccccca |
1375283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 8738881 - 8738987
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||| |||||||||| || ||||||||||||||| |||||||||| |||||||||||||| |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
8738881 |
aaaaattgcggttatagcctcctaactaatttaaatacaaaacagctccctatgttttgattctttgacagttttggacccccagtccattagtgaggtg |
8738980 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
8738981 |
ccacgtg |
8738987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 21552821 - 21552731
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
21552821 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacctccagtccatt |
21552731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 25 - 111
Target Start/End: Original strand, 26717210 - 26717296
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtgccac |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
26717210 |
ccccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgcacccccagtccattagtgaggtgccac |
26717296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 31784531 - 31784441
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31784531 |
aaaagttgcggttatggacccctaactaatttaaatacaaagcagccccctatgttttgattctttggcagttttggacccccagtccatt |
31784441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 35699139 - 35699041
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatta |
99 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
35699139 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatattttgattctttgacagttttggacccccagtccatta |
35699041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39620571 - 39620661
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39620571 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
39620661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 40324667 - 40324757
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40324667 |
aaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccaatccatt |
40324757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 21568205 - 21568122
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21568205 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
21568122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 22093268 - 22093351
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22093268 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
22093351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 1466836 - 1466926
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1466836 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattcttttgcagttttggaccccca |
1466926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 11366825 - 11366915
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11366825 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattatttggcagttttggaccccca |
11366915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 19256876 - 19256786
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
19256876 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttggaccccca |
19256786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 25888171 - 25888081
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||||||| | |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25888171 |
aaaagttacggttatggacccctaactaatttaaatacaaaacagacccctatgttttgattctttggcagttttggacccccagtccatt |
25888081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 38731559 - 38731469
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38731559 |
aaaagttgcagttattgacccctaactaatttaaatacaaaacagtctcctatgttttgattctttggcagttttggacccccagtccatt |
38731469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 1374824 - 1374921
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
1374824 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaatagccccctatgtttcgattctttgacagttttggacccccagtccatt |
1374921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 41829495 - 41829584
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
41829495 |
tctttccaaaagttgcggttatggacccataactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccc |
41829584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 45395525 - 45395436
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||| |
|
|
| T |
45395525 |
tctttctaaaaattgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattatttggcagttttgaaccccc |
45395436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 20494598 - 20494526
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20494598 |
cccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccacagtccatt |
20494526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 13732193 - 13732280
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||||||||||| || ||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
13732193 |
tctttctaaaagttacgattatggacccctaactaatttaaatacaaaacagcctcctatgttttgattctttggcagtttttgaccc |
13732280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 95
Target Start/End: Complemental strand, 20436333 - 20436246
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcc |
95 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| | ||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20436333 |
aaaagttgctgttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcagttttggacccccagtcc |
20436246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 36589764 - 36589867
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| | |||||| | ||||| |||||||| |||| ||||||||||||| ||||||||||| |||||| |
|
|
| T |
36589764 |
aaaagttgcggttatggccccctaactaatttaaatataaaacaagcccctatcttttgattctttgacagttttggaccctcagtccattagtgaggtg |
36589863 |
T |
 |
| Q |
108 |
ccac |
111 |
Q |
| |
|
|||| |
|
|
| T |
36589864 |
ccac |
36589867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 40493925 - 40493842
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
40493925 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggaccccca |
40493842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 8519292 - 8519382
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
8519292 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagccccctatgtttcgattctttggcagttttggaccccca |
8519382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 20494365 - 20494451
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
20494365 |
tctttttaaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacc |
20494451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 24858156 - 24858066
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||| |||| | ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24858156 |
aaaagttgcggttatgaacccctaactaatttaaatacaaacgagccccatatattttgattctttggcagttttggacccccagtccatt |
24858066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 25887920 - 25888010
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
25887920 |
tctttccaaaagttgcggttatggaccactaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttagaccccca |
25888010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 39620828 - 39620738
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||| | |||||| || |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39620828 |
aaaatttgcggttatggacccctaactaatttaaatataaaacaaccccctatgttttgattctttggcagttttggacccccagtccatt |
39620738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 41071855 - 41071945
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
41071855 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaaccccca |
41071945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 41072115 - 41072025
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
41072115 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattctttggcagttttggacaccca |
41072025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 42445659 - 42445570
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
42445659 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatg-tttgattctttggcaattttggaccccca |
42445570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 7464226 - 7464129
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||| | ||||||||| |||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
7464226 |
tctttccaaaagttacggttatggacccctaactaatttaaatataaaacagccccctatgttttgattctttggcaattttagacccccagtccatt |
7464129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 9484727 - 9484812
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
9484727 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggac |
9484812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 13123448 - 13123545
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||||||| ||||||| ||| ||||||||||||| ||||||||| | |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13123448 |
tctttttaaaagttgaggttatggacccataactaatttaaatacaaaacagtcccctatgttttgattctttagcagttttggacccccagtccatt |
13123545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 13485453 - 13485372
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
13485453 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccc |
13485372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 21552574 - 21552655
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
21552574 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
21552655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 31784285 - 31784366
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||| |
|
|
| T |
31784285 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggacccc |
31784366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 41829745 - 41829664
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
41829745 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttagcagttttggacccc |
41829664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 22093498 - 22093418
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||| |
|
|
| T |
22093498 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccc |
22093418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 33004742 - 33004825
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||| |||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33004742 |
aaaagttgcagttatggacctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
33004825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 34123521 - 34123438
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
34123521 |
aaaagttgcggttatggactcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagtcttggaccccca |
34123438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 34981662 - 34981580
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34981662 |
aaaagttgcggttatggacctctaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggaccccca |
34981580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 3 - 85
Target Start/End: Complemental strand, 2382842 - 2382760
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga |
85 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||| |
|
|
| T |
2382842 |
tttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttgga |
2382760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 86
Target Start/End: Complemental strand, 11362841 - 11362763
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac |
86 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
11362841 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggac |
11362763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 32 - 98
Target Start/End: Original strand, 19256645 - 19256711
Alignment:
| Q |
32 |
actaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
19256645 |
actaatttaaatacaaaacagcctcctatgttttgattctttggcaattttggacccccagtccatt |
19256711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 34981417 - 34981507
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
34981417 |
aaaagttgcggttatagacccttaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttggatccccagtccatt |
34981507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 36987438 - 36987528
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
36987438 |
tctttccaaaagttgcgtttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagtttttgaccccca |
36987528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 1467088 - 1467003
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagt |
93 |
Q |
| |
|
|||||||| ||||||| ||||||| ||||||||| ||||||||||| |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
1467088 |
aaaagttgtggttatggacccctaattaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaaccccagt |
1467003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 11367087 - 11366998
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
11367087 |
tctttccaaaagttgcggctatggacccataactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccc |
11366998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 74
Target Start/End: Original strand, 19473102 - 19473174
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttg |
74 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
19473102 |
tctttctaaaagttgcggttatggccccctaactaatttaaatacaaaacaacc-cctatgttttgattttttg |
19473174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 35698905 - 35698970
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35698905 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
35698970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 38731312 - 38731393
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
38731312 |
aaaagttgcggttattgtctcctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
38731393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 40711369 - 40711450
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| ||||||||| |||| |
|
|
| T |
40711369 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagttttggccccc |
40711450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 2936822 - 2936897
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
2936822 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttaattctttggcagttttg |
2936897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 20436091 - 20436174
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||| |||||||| || |||||||||||||| |||||||||||| |||||||| |
|
|
| T |
20436091 |
aaaagttgcagttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttagaccccca |
20436174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 22136919 - 22137006
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccc |
88 |
Q |
| |
|
|||||| ||||||| | |||||| ||| ||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
22136919 |
tctttccaaaagttacagttatggacccttaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccc |
22137006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 22194728 - 22194645
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
22194728 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccctctatgttttgattctttagcaattttggaccccca |
22194645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 24205327 - 24205410
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| | | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24205327 |
aaaagttgcggttatggacccctaactaatttaaatacaaaataactccctatgttttgattctttggcagttttggaccccca |
24205410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 33004972 - 33004901
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagt |
79 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
33004972 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagt |
33004901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 39643009 - 39642926
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39643009 |
aaaagttgcggttatggacccataactaatttaaatacaaaacagccctatatgttttgattctttggcagttttggaccccca |
39642926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 96
Target Start/End: Original strand, 15977259 - 15977329
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15977259 |
cccctaactaatttaaatacaaaacagccccttatgttttgattgtttggcagttttgaacccccagtcca |
15977329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 24205576 - 24205486
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||| || |||||||||| |||||||||||||| |
|
|
| T |
24205576 |
aaaagttgcggttatggacccctaattaatttaaatacaaaacagccctttatgttttgattcttcggcagttttgaacccccagtccatt |
24205486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39431195 - 39431285
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||| ||| ||||||||||| |||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
39431195 |
tctttccaaaagttgcggttatggacccctaactaattcaaatacaaaacagccctctatattttgattctttagcagttttggaccccca |
39431285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 11362594 - 11362675
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||||||||||| | |||||||||||| |||||||||||| |||||| |
|
|
| T |
11362594 |
aaaagttgcggttatggacacctaactaatttaaatacaaaacagccccatatgttttgattctttggcagttttagacccc |
11362675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 39245695 - 39245792
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| ||||| |||||||||| | | |||||||||||||| |||||||| ||| ||||||||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
39245695 |
tctttttaaaatttgcggttataaatctctaactaatttaaatacaaaacaaccttctatgttttgattctttggcagttttggatccccggtccatt |
39245792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 7463973 - 7464061
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||| ||||||| ||| || |||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
7463973 |
tctttttaaaagttgtggttatgtacccatatctaatttaaatacaaaacagccccttatgttttgattctttggcagttttggacccc |
7464061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 28217160 - 28217072
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||| ||| ||||||||||||| ||||| ||| |||||||||||||||| |||| |
|
|
| T |
28217160 |
tctttctaaaagttgcgattttggccccctaactaattaaaatacaaaacagcctcatatgtattggatttttggcagttttggccccc |
28217072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 87
Target Start/End: Original strand, 45126872 - 45126951
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| | | |||||||||||| ||||| ||||||||||| |
|
|
| T |
45126872 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtcccttatgttttgattctttggtagttttggacc |
45126951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 13123701 - 13123621
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||| || ||||| ||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
13123701 |
aaaagttacgtttatggacccctaactaatttaaatacaaaacagccccctatg-tttgattctttggcagttttggacccc |
13123621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 25429948 - 25430013
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
25429948 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacaaccccctatgttttg |
25430013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 2 - 98
Target Start/End: Original strand, 7537440 - 7537536
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||| |||||||||||||| | ||||||||||||||||| ||||||||| | |||||||| |||| |||| |||||||||||||||| ||||| |
|
|
| T |
7537440 |
ctttccaaaagttgcggttacggacccctaactaatttaaatacaaaacagacctctatgtttggattctttgttagttttggacccccagaccatt |
7537536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 15977489 - 15977413
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||| || ||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
15977489 |
aaaagttgtggttatggacccctaagtaatttcaatacaaaacagccccctatgttttgattctttggcagttttgg |
15977413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 40711615 - 40711527
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| |||||| | || ||||||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
40711615 |
aagttgcgattatggacccctaactaatttaaatacaaaataacccactatgttttgattctttgacagttttgaacccccagtccatt |
40711527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 45127123 - 45127055
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgatt |
69 |
Q |
| |
|
|||||| ||||||||| |||||| ||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45127123 |
tctttccaaaagttgcagttatggacccctaactaatttaaatacaaaacagccccctatgttttgatt |
45127055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 1375072 - 1375151
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtt |
80 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||| |||||||| || |||||||||||||| |||| ||||| |
|
|
| T |
1375072 |
tctttccaaaagttacggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattatttgacagtt |
1375151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 74
Target Start/End: Complemental strand, 24895191 - 24895125
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttg |
74 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| |||| |
|
|
| T |
24895191 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccatatgttttgattctttg |
24895125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 66
Target Start/End: Original strand, 36566636 - 36566694
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttg |
66 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
36566636 |
aaaagttgcggttatggcctcctaactaatttaaatacaaaacagccccctatgttttg |
36566694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 36566738 - 36566688
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36566738 |
tctttccaaaagttgcggttatgaccccctaactaatttaaatacaaaaca |
36566688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 39642762 - 39642852
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || |||||||| | |||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
39642762 |
aaaagttgcggttatggacccctaactaattttaatacaaaacaactctttatgttttgattctttgtcagttttggacccccaatccatt |
39642852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 10741358 - 10741278
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
10741358 |
aaaagttgcggttttgaccccctaactaattaaaatacaaaacagcc-cctatgtattggatctttggcagttttggccccc |
10741278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 36286156 - 36286237
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||||||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
36286156 |
aaaagttgcgattttggccccctaactaattaaaacacaaaacagccccctatgtattggatctttggcagttttggccccc |
36286237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 19025857 - 19025935
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| |||| |||||||| ||||||||||| |||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
19025857 |
aaaagttgcggttatgaacccc-----aatttaaatacaaaacagccccctatgttttgattctttggtagttttgggccccca |
19025935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 28733264 - 28733189
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||| || || |||| ||||||||| ||| ||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
28733264 |
aaaagttgcgattttggccccttaactaattaaaatacaaaacagcctcctatgtattggatttttggcagttttg |
28733189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 32661722 - 32661639
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
32661722 |
tctttccaaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
32661639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 35173094 - 35173011
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||| || |||||||||||| |||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||||| |
|
|
| T |
35173094 |
aaaagttgcgattttgaccccctaacaaattaaaatacaaaacagccccctatgtattggatctttggcagttttggcccccca |
35173011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 23280918 - 23280836
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| | ||||||||||||| |
|
|
| T |
23280918 |
tctttctaaaagttgcgattttggccccctaactaattaaaatacaaaacacccccctatgtattggatctttggcagttttg |
23280836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 39245952 - 39245862
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||| ||||| | |||||| |||||||| | ||||||||| |||||||||||||| |||| | ||||||||||||| |
|
|
| T |
39245952 |
tctttccaaaagttgcgattatggactcctaaccaatttaaatataaaacagccccctatgttttgattctttgataattttggaccccca |
39245862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 37343963 - 37343882
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || |||| |||||||||||||||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
37343963 |
aaaagttgcgattttgactccctaactaatttaaatacaaaacaaccccctatgtattggatctttggcagttttggccccc |
37343882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 28451993 - 28451905
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||| ||||||||| | || || ||| |||||||||| ||| ||||||||||| ||||||| |||| | |||||||||||||| |||| |
|
|
| T |
28451993 |
tctttttaaaagttgtgattttggccctctaactaattaaaatacaaaacagccccctatgtattgaatctttggcagttttggccccc |
28451905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 89
Target Start/End: Original strand, 28719352 - 28719431
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| |||||| |||| ||||||| ||| |||||||||||||||| |||| |
|
|
| T |
28719352 |
aagttgcgattttggccccctaactaattaaaatacaaaatagccccctatgtattggatttttggcagttttggccccc |
28719431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 44077121 - 44077184
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| ||| | |||||||||||||| |||| |
|
|
| T |
44077121 |
cccctaactaattaaaatacaaaacagcctcctatgtattggatctttggcagttttggccccc |
44077184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 11017631 - 11017689
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctccta |
59 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||||||||| |||| |
|
|
| T |
11017631 |
tctttcaaaaagttgcggttatagacccctaactaatttaaatacaaaacagcccccta |
11017689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 22699489 - 22699543
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
22699489 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgt |
22699543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 23686762 - 23686700
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||| ||| |||||||||||||||| |||| |
|
|
| T |
23686762 |
ccctaactaattaaaatacaaaacagccacctatgtattggatttttggcagttttggccccc |
23686700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 25430057 - 25430007
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
|||||| ||||||||| |||||| |||||||||||||||||| |||||||| |
|
|
| T |
25430057 |
tctttccaaaagttgcagttatggccccctaactaatttaaatacaaaaca |
25430007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 43890207 - 43890269
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
43890207 |
tgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
43890269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 11364593 - 11364512
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||| || || || |||||||||||||| ||| ||||||||||||| ||||| ||| | |||||||||||||| |||| |
|
|
| T |
11364593 |
aaaagttacgattttggccccctaactaattaaaatacaaaacagcctcttatgtattggatctttggcagttttggccccc |
11364512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 16238503 - 16238422
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||| ||||||||||| ||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
16238503 |
aaaagttgcggtgttgaccccctaattaattaaaatacaaaacagccccctatgtattggatctttgacagttttggccccc |
16238422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 32661437 - 32661518
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||| | ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
32661437 |
aaaagttgcgattttgtccccctaactaattaaaatacaaaacagtcccctatgtattggatctttggcagttttggccccc |
32661518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 36286441 - 36286380
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||| |||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
36286441 |
tctttccaaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgt |
36286380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 98
Target Start/End: Complemental strand, 7538531 - 7538459
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||| | ||||||||| | || |||| ||||||||| |||||| ||||| |
|
|
| T |
7538531 |
cccctaactaatttaaatacaaaacagacccctatgtttgggttctttgttagttttggatccccagaccatt |
7538459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 90
Target Start/End: Complemental strand, 14983963 - 14983899
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| ||||| |
|
|
| T |
14983963 |
cccctaactaattaaaatacaaaacagccccctatgtattgcatctttggcagttttggcccccc |
14983899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 134
Target Start/End: Original strand, 24365005 - 24365049
Alignment:
| Q |
91 |
agtccattagcgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
24365005 |
agtccattagtgaggtgccacgttgccccctaaataatacacgtg |
24365049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 24857909 - 24857961
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagc |
53 |
Q |
| |
|
|||||| |||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
24857909 |
tctttccaaaagttgcggttatggactcctaactaatttaaatacaaaacagc |
24857961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 39374410 - 39374334
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
||||||||| || ||||||||||||||||| ||| ||||||||||| ||||||| ||| | |||||| ||||||| |
|
|
| T |
39374410 |
aaaagttgcaattttgaccccctaactaattaaaatacaaaacagccccctatgtattggatctttggccgttttgg |
39374334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 83
Target Start/End: Complemental strand, 40939082 - 40939026
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||| ||| || ||||||||||||| |
|
|
| T |
40939082 |
ccctaactaattaaaatacaaaacagccccctatgtattggttctttggcagttttg |
40939026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 44 - 91
Target Start/End: Complemental strand, 1375042 - 1374995
Alignment:
| Q |
44 |
acaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||| || | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
1375042 |
acaaaacaaccccatatgttttgattctttggcagttttggaccccca |
1374995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 35180573 - 35180490
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| || || ||||||||| |||| ||| ||||||||||| ||||||| ||| | ||||| |||||||| |
|
|
| T |
35180573 |
tctttccaaaagttgcgattttggccccctaacaaattaaaatacaaaacagccccctatgtattggatatttggtagttttgg |
35180490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 49
Target Start/End: Original strand, 45395258 - 45395305
Alignment:
| Q |
2 |
ctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaa |
49 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45395258 |
ctttccaaaagttgcggttatgtacccctaactaatttaaatacaaaa |
45395305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 82
Target Start/End: Complemental strand, 11134007 - 11133949
Alignment:
| Q |
24 |
accccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||| ||||| ||| ||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
11134007 |
accccctaattaattaaaatacaaaacagccccctatgtattggatttttggcagtttt |
11133949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 11188339 - 11188393
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
11188339 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgt |
11188393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 16238145 - 16238199
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgt |
62 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
16238145 |
aaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgt |
16238199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 89
Target Start/End: Original strand, 20480109 - 20480190
Alignment:
| Q |
7 |
taaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| |||| | ||||| |||||||| |||| |
|
|
| T |
20480109 |
taaaagttgcaattttggccccctaactaattaaaa-acaaaacagccccctatgtattgaatctttggtagttttggccccc |
20480190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 10857365 - 10857418
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcc |
54 |
Q |
| |
|
|||||| |||||||||| || || |||||||||||||| ||| ||||||||||| |
|
|
| T |
10857365 |
tctttccaaaagttgcgattttggccccctaactaattaaaatacaaaacagcc |
10857418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Complemental strand, 19889498 - 19889417
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || || ||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
19889498 |
aaaagttgcgattttggcctcctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttggccccc |
19889417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 83
Target Start/End: Original strand, 23048325 - 23048398
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| ||||||||||| | ||||| |||| | |||| |||||||| |
|
|
| T |
23048325 |
aagttgcgattttggccccctaactaattaaaatacaaaacagccccttatgtattgaatctttgacagttttg |
23048398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 31025908 - 31025989
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||| |||||||||| ||| |||||||| || |||||||||| | |||||||||||||| |||| |
|
|
| T |
31025908 |
aaaagttgcgattttggccctctaactaattaaaatacaaaacaaccctctatgttttggatctttggcagttttggccccc |
31025989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 37343685 - 37343766
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | ||| |||||||||| |||| |
|
|
| T |
37343685 |
aaaagttgcgattttggtcccctaactaattaaaatacaaaacagccccctatgtattggatctttagcagttttggccccc |
37343766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 10 - 83
Target Start/End: Complemental strand, 43741780 - 43741708
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||| || ||| ||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
43741780 |
aagttgcgattttgatcccctaactaattaaaatacaaaacagcc-cctatgtattgcatctttggcagttttg |
43741708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 52303 - 52239
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
52303 |
ccccctaactaattaaaatacaaaacaaccccctatgtgttggatctttggcagttttggccccc |
52239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 12542172 - 12542248
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||| | || || |||||||||||||| ||| ||||||||||| ||||| | ||| | |||||||||||||| |
|
|
| T |
12542172 |
aaaagttgtgattttggccccctaactaattaaaatacaaaacagccccctatatattggatctttggcagttttgg |
12542248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 21633271 - 21633207
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| ||| | |||| ||||||||| |||| |
|
|
| T |
21633271 |
ccccctaactaattaaaatacaaaacagccccctatgtattggatctttgccagttttggccccc |
21633207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 28719427 - 28719491
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| ||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
28719427 |
ccccctaactgattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
28719491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 82
Target Start/End: Complemental strand, 28857850 - 28857790
Alignment:
| Q |
22 |
tgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
||||||||||||||||| ||| |||||| ||| ||||||| |||| | |||||||||||| |
|
|
| T |
28857850 |
tgaccccctaactaattaaaatacaaaatagctccctatgtattgaatctttggcagtttt |
28857790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 1623 - 1510
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1623 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccattag |
1524 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1523 |
tgaggtgccacgtg |
1510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 1388 - 1515
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |||||||||| |||||| |
|
|
| T |
1388 |
aaaagttgcggtcatggccccctaactaatttaaatacaaaacagccccctatgttttgattttttgacatttttggacccctagtccattagtgaggtg |
1487 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
1488 |
ccacgtggccccctaaataatacacgtg |
1515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 4808 - 4675
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||| |||||||| | |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4808 |
tctttccaaaagttgcggttatgaccca-taactaatttaaatacaaaacaatcccctatgttttaattttttggcagttttggacccccagtccattag |
4710 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
4709 |
tgaggtgccacgtggccccctaaataatacacgtg |
4675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 4574 - 4680
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
4574 |
aaaagttgcgtttatggccctctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccctcagtccattagtgaggtg |
4673 |
T |
 |
| Q |
108 |
ccacgtg |
114 |
Q |
| |
|
||||||| |
|
|
| T |
4674 |
ccacgtg |
4680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 84; Significance: 5e-40; HSPs: 5)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 8 - 134
Target Start/End: Original strand, 20901 - 21028
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggtg |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
20901 |
aaaagttgcggttatagccccctaactaatttaaatacaaaacagccccctatgttttgattttttggcagttttggacccccagtccattagtgagatg |
21000 |
T |
 |
| Q |
108 |
ccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
||||| | || |||||||||||||||| |
|
|
| T |
21001 |
tcacgtggtcctctaaataatacacgtg |
21028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 10841 - 10751
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10841 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagtctcctatgttttgattctttggcagttttggacccccagtccatt |
10751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 21136 - 21023
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||||||||||| |||||||| || | |||||||||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
21136 |
tctttccaaaagttgcggtaatggccccctaactaatttaaatacaaaacaaccccttatgttttgattctttggcagttttagaccctcagtccattac |
21037 |
T |
 |
| Q |
101 |
cgaggtgccacgtg |
114 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21036 |
tgaggtgccacgtg |
21023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 30 - 91
Target Start/End: Original strand, 10614 - 10675
Alignment:
| Q |
30 |
taactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||| ||||||||||| | |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
10614 |
taactaatttaaatacaaaacagccccttatgttttgattctttagcagttttggaccccca |
10675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #5
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 67 - 134
Target Start/End: Complemental strand, 11631 - 11563
Alignment:
| Q |
67 |
attttttggcagttttggacccccagtccattagcgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| || ||||| | || |||||||||||||||| |
|
|
| T |
11631 |
attttttggcagttttagacccccagtccattagtgagatgtcacgtggtcctctaaataatacacgtg |
11563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 21334 - 21203
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||| |||||| || | |||||||||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
21334 |
tctttccaaaagttgcggttatggccccctaactaatttaaatacaaaagagtcccctatgttttgattctttggcagttttgaaccccgagtccattag |
21235 |
T |
 |
| Q |
101 |
cgaggtgccacgt-gccccctaaataatacac |
131 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |
|
|
| T |
21234 |
tgaggtgccacgtggccccctaaataatacac |
21203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 21092 - 21201
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccattag |
100 |
Q |
| |
|
|||||| |||| ||||| ||||| |||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21092 |
tctttccaaaatttgcgattatggccccctaactaatttaaatacaaaacagccctctatgttttgattctttggcagttttggacccccagtccattag |
21191 |
T |
 |
| Q |
101 |
cgaggtgcca |
110 |
Q |
| |
|
||||||||| |
|
|
| T |
21192 |
tgaggtgcca |
21201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 8 - 114
Target Start/End: Original strand, 26296 - 26403
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacac-aaaacagcctcctatgttttgattttttggcagttttggacccccagtccattagcgaggt |
106 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || ||||||||| |||||||||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
26296 |
aaaagttgcggttatggccccctaactaatttaaataccaaaacagccccctatgttttgattctttgacagttttggacccccagtccattagtgaggt |
26395 |
T |
 |
| Q |
107 |
gccacgtg |
114 |
Q |
| |
|
|||||||| |
|
|
| T |
26396 |
gccacgtg |
26403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 26534 - 26398
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggac--ccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||||||||||| |||||||| | ||||| |||| ||| |||||||||||||||| |||||||||||| |
|
|
| T |
26534 |
tctttccaaaagttgcggttatggctccctaactaatttaaatacaaaacaatcccctatattttaattgtttggcagttttggacccccccagtccatt |
26435 |
T |
 |
| Q |
99 |
agcgaggtgccacgt-gccccctaaataatacacgtg |
134 |
Q |
| |
|
|| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26434 |
agtgaggtgccacgtggccccctaaataatacacgtg |
26398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 9973 - 10063
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9973 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
10063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 10224 - 10127
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||| |||||||||||||||||| |||| |
|
|
| T |
10224 |
tctttctaaaagttgcggttatggatccctaactaatttaaatacaaaacagccccctatgttttgattctttgccagttttggacccccagttcatt |
10127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 1217 - 1307
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1217 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
1307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 8 - 90
Target Start/End: Complemental strand, 1464 - 1382
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccc |
90 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
1464 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgtttcgattctttggcagttttggaccccc |
1382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 20628 - 20711
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20628 |
aaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
20711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 20901 - 20812
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20901 |
tctttccaaaagttgcggttatggacccttaactaatttaaatacaaaacagcc-cctatgttttgattctttggcagttttggaccccca |
20812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 12080 - 12151
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacag-cctcctatgttttgattttttggcag |
78 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||| |||||| || || |||||||||||||| |||||||| |
|
|
| T |
12080 |
aaaagttgcggttatggacccctaattaatttaaatacaaaatagtccccctatgttttgattctttggcag |
12151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 157 - 67
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
157 |
tctttctaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttttggaccccca |
67 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 5618 - 5708
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
5618 |
tctttccaaaagttgcggttatgaacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggcccccca |
5708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 5880 - 5785
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||||||||||| |||||||| || |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
5880 |
tctttccaaaagttgcggttatggaccccttactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttgaacccccagtcca |
5785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 139201 - 139291
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
139201 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccacctatgttttgattctttggcagttttggaccccca |
139291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 139461 - 139365
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
139461 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgga-ccccagtccatt |
139365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 400993 - 400903
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
400993 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
400903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 400730 - 400828
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgga-cccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
400730 |
tctttccaaaagttgcggttatggaacactaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccccagtccatt |
400828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 120 - 32
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
120 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccc |
32 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 64; Significance: 4e-28; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 10654 - 10749
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
10654 |
tctttccaaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
10749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 15944 - 16039
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| |||||||||| ||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
15944 |
tctttccaaaagttgcgattatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccccagtcca |
16039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 10915 - 10835
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
10915 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttt |
10835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 16205 - 16125
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttt |
81 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
16205 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccttatgttttgattctttggcagttt |
16125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 29938 - 29843
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||||||||| ||||||||||| |||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
29938 |
tctttccaaaagttacggttatggacccctaactaatttaaatacaaaacagccccctatgttttgatttttttgcagttttgaacccccagtcca |
29843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 29676 - 29766
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
29676 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggcccccca |
29766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 64; Significance: 4e-28; HSPs: 4)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 8 - 91
Target Start/End: Complemental strand, 79267 - 79184
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
79267 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggaccccca |
79184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 12945 - 12848
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
12945 |
tctttctaaaagttgcggttatggatccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggatccccagttcatt |
12848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 79016 - 79113
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
79016 |
tctttccaaaagttgtggttatggtttcctaactaatttaattacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
79113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 27 - 91
Target Start/End: Original strand, 12709 - 12773
Alignment:
| Q |
27 |
ccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12709 |
ccctaactaatttaaatacaaaacggctctctatgttttgattctttggcagttttggaccccca |
12773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 3731 - 3828
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| |||||| |||| |||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
3731 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaatagccccctatgttttgattctttggcatttttggacccccagtccatt |
3828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 56 - 91
Target Start/End: Complemental strand, 3934 - 3899
Alignment:
| Q |
56 |
cctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3934 |
cctatgttttgattctttggcagttttggaccccca |
3899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 7747 - 7844
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| ||||||||| | |||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
7747 |
tctttccaaaagttgcggttatggacctctaactaatttaaatacaaaacagtcccctatgttttgattctttggcagttttgaacccccagtccatt |
7844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 8008 - 7945
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttt |
64 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||| ||||||||||| ||||||||| |
|
|
| T |
8008 |
tctttccaaaagttgcggttatggacccctaaataatttaaatacaaaacagccccctatgttt |
7945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 14592 - 14495
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
14592 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttaacagttttggacccccaatccatt |
14495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 20913 - 20816
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| |||||||| || | |||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
20913 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccatatgttttgattctttggcagttttggacccctagtccatt |
20816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 91
Target Start/End: Original strand, 20659 - 20742
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20659 |
aaaagttgcggttatggacccctaactaatttaaatacaaaacaaccccctatgttttgattctttggcagttttggaccccca |
20742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 26213 - 26285
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
26213 |
cccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttggacccccagtccatt |
26285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 81589 - 81501
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||| || ||||||||||| |
|
|
| T |
81589 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattttttgccaattttggacccc |
81501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 81331 - 81421
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| | ||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
81331 |
tctttccaaaagttgtggttatggacccctaactaatttaaatataaaacagtcccctatgttttgattctttagcagttttggaccccca |
81421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 3 - 91
Target Start/End: Complemental strand, 2930 - 2843
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
2930 |
tttctaaaagttggggttatggacccctaactaatttaaatacaaaacagccccctatg-tttgattctttggcagttttggaccccca |
2843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 2670 - 2767
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||| |||||| || | | |||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
2670 |
tctttccaaaagttgtggttatggacccctaactaatttaaatacaaaatagtcccttatgttttgattctttggcagttttggacctccagtccatt |
2767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 57; Significance: 6e-24; HSPs: 4)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 238655 - 238743
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtcca |
96 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
238655 |
aaaagttgtggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttggcagttttgaacccctagtcca |
238743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 238911 - 238821
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggaccccca |
91 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
238911 |
tctttccaaaagttgcggttatgtacccctaactaatttaaatacaaaacagccctatatgttttgattctttggcagttttggcccccca |
238821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 3 - 83
Target Start/End: Original strand, 22818 - 22898
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||| |||||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
22818 |
tttctagaagttgcgattttggacccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
22898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 22901 - 22964
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||| ||||||| ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
22901 |
cccctaactaattaaaatacataacagccccctatgttttggatttttggtagttttggccccc |
22964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 87
Target Start/End: Complemental strand, 1034 - 948
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||| | |||||||||||||||||||||||| |||| ||||||| |||| |
|
|
| T |
1034 |
tctttctaaaagttgcggttatggacctctaactaatttaaatataaaacagcctcctatgttttgattctttgacagttttagacc |
948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 789 - 869
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagtttt |
82 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||||| ||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
789 |
tctttccaaaagttgcggttacggacccctaactaatttaaatacaaaacagcc-cccatgttttgattttttggcagtttt |
869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 845 - 941
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||| |||||||||| ||||| |||| |||||||||||| ||||||| ||| |||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
845 |
tctttccaaaagttgcgtttatggaccccaaactaatttaaatacaaaac-gccccctatgttttgattctttggcagttttggacccctagtccatt |
941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 6894 - 6972
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagt |
79 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
6894 |
tctttccaaaagttgcggttatggacccctaactaatttaaatacaaaacagccccctatgttttgattctttgacagt |
6972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 48; Significance: 2e-18; HSPs: 4)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 8 - 87
Target Start/End: Complemental strand, 75355 - 75276
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacc |
87 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||| |||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
75355 |
aaaagttgcggttatggatccctaactaatttaaatacaaaagagccccctatgttttgattatttgacagttttggacc |
75276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 3 - 60
Target Start/End: Original strand, 75138 - 75195
Alignment:
| Q |
3 |
tttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctat |
60 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
75138 |
tttccaaaagttgccgttatggacccctaactaatttaaatacaaaacagccccctat |
75195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 199719 - 199782
Alignment:
| Q |
26 |
cccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
199719 |
cccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttggccccc |
199782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 201257 - 201198
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||| ||| | |||| ||||||||| |
|
|
| T |
201257 |
ccccctaactaattaaaatacaaaacagcctcctatgtattggatctttgacagttttgg |
201198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 32297 - 32214
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| || || |||||||||||||| ||| ||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
32297 |
tctttccaaaagttgcgattttggccccctaactaattaaaatacaaaacagccccctatgttttggatttttggcaattttgg |
32214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 32005 - 32093
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| ||||||||| || || |||||||||||||| ||| ||||||||||| ||||||| ||| | ||| |||||||||| |||| |
|
|
| T |
32005 |
tctttccaaaagttgcaattttggccccctaactaattaaaatacaaaacagccccctatgtattggatctttagcagttttggccccc |
32093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 98
Target Start/End: Original strand, 16552 - 16642
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccccagtccatt |
98 |
Q |
| |
|
|||||||||||||||| | ||||||||||||| | ||||||||| |||| ||||||||| ||||||||||||| |||||| ||||||| |
|
|
| T |
16552 |
aaaagttgcggttatgcacttttaactaatttaaatataaaacagccccctacgttttgattctttggcagttttgaacccccggtccatt |
16642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 122617 - 122534
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||| |||||||||| || || || ||||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
122617 |
tctttccaaaagttgcgattttggcctcctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttgg |
122534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 3808 - 3866
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctccta |
59 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| ||||||||||| |||| |
|
|
| T |
3808 |
tctttccaaaagttgcggttatggaaccctaactaatttaaatacaaaacagcccccta |
3866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 46926 - 47014
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||| |||||||||| || | |||||||||||||| ||| ||||||||||| | ||||| ||| | |||||||||||||| |||| |
|
|
| T |
46926 |
tctttcaaaaagttgcgattttagccccctaactaattaaaatacaaaacagccccttatgtattggatctttggcagttttggccccc |
47014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 47136 - 47073
Alignment:
| Q |
25 |
ccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||||||| ||| |||||||| || ||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
47136 |
ccccctaactaattaaaatacaaaacaacc-cctatgtattggatttttggcaattttggacccc |
47073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0854 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0854
Description:
Target: scaffold0854; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 3406 - 3327
Alignment:
| Q |
10 |
aagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||| || || |||||||||||||| ||| |||||||| || ||||||| ||| | |||||||||||||| |||| |
|
|
| T |
3406 |
aagttgcgattttggccccctaactaattaaaatacaaaacaaccccctatgtattggatctttggcagttttggccccc |
3327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: scaffold0047
Description:
Target: scaffold0047; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 63344 - 63269
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttg |
83 |
Q |
| |
|
|||||||||| || || ||||||||||||| ||| ||||||||||| ||||||| ||| | ||||||||||||| |
|
|
| T |
63344 |
aaaagttgcgattttggtcccctaactaattaaaatacaaaacagccccctatgtattggatctttggcagttttg |
63269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0047; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 63068 - 63149
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || ||||||||||||| ||| |||||||| || ||||||||||| | |||| ||||||||| |||| |
|
|
| T |
63068 |
aaaagttgcgattttggtcccctaactaattaaaatacaaaacaaccccctatgttttggatctttgtcagttttggccccc |
63149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0354 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0354
Description:
Target: scaffold0354; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 7372 - 7422
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaaca |
51 |
Q |
| |
|
||||||||||||||||| || || |||||||||||||| ||| |||||||| |
|
|
| T |
7372 |
tctttctaaaagttgcgattttgtccccctaactaattaaaatacaaaaca |
7422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2010 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold2010
Description:
Target: scaffold2010; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 89
Target Start/End: Original strand, 526 - 607
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttggacccc |
89 |
Q |
| |
|
|||||||||| || || |||||||| ||||| ||| ||||||||||| ||||||| || | |||||||||||||| |||| |
|
|
| T |
526 |
aaaagttgcgattttggccccctaaataattaaaatacaaaacagccccctatgtattagatctttggcagttttggccccc |
607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 8997 - 8935
Alignment:
| Q |
1 |
tctttctaaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgtttt |
65 |
Q |
| |
|
|||||| |||||||| |||||||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
8997 |
tctttccaaaagttgtggttatgaccg--taactaatttaaatacaaaacagcaccctatgtttt |
8935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0279 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0279
Description:
Target: scaffold0279; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 7195 - 7120
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttttgattttttggcagttttgg |
84 |
Q |
| |
|
|||||||||| || || |||| ||||||||| ||| ||||||||||| ||||||| ||| | |||||||||||||| |
|
|
| T |
7195 |
aaaagttgcgattttggccccgtaactaattgaaatacaaaacagcc-cctatgtattggatctttggcagttttgg |
7120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 64
Target Start/End: Complemental strand, 55433 - 55377
Alignment:
| Q |
8 |
aaaagttgcggttatgaccccctaactaatttaaacacaaaacagcctcctatgttt |
64 |
Q |
| |
|
|||||||||| || || |||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
55433 |
aaaagttgcgattttggccccctaactaattagaatacaaaacagccccctatgttt |
55377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University