View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_130 (Length: 246)
Name: NF6131_low_130
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_130 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 89 - 246
Target Start/End: Original strand, 36636911 - 36637068
Alignment:
| Q |
89 |
tattctaaacataaaatacacctactcaatcaatcaacttattttaatcctatttttaccaatgttggtatgccttcagctgatacttatgttcttctca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636911 |
tattctaaacataaaatacacctactcaatcaatcaacttattttactcctatttttaccaatgttggtatgccttcagctgatacttatgttcttctca |
36637010 |
T |
 |
| Q |
189 |
gaattttatttttcatgataannnnnnngcctcacttaagactctttagaatagttat |
246 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36637011 |
gaattttatttttcatgataattcttttgcctcacttaagactctttagaatagttat |
36637068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University