View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6131_low_138 (Length: 241)

Name: NF6131_low_138
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6131_low_138
NF6131_low_138
[»] chr2 (1 HSPs)
chr2 (1-156)||(27409080-27409235)
[»] chr1 (1 HSPs)
chr1 (153-223)||(33421554-33421624)


Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 27409080 - 27409235
Alignment:
1 tcttattggacttatcatacactaacgaactgttgtgttttattgaatttcactaaattaggaagtcaacttacacacaacgcacacctctctacaatga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||    
27409080 tcttattggacttatcatacactaacgaactgttgtgttttattgaatttcactaaattaggaagtcaacttaaacacaatgcacacctctctacaatga 27409179  T
101 tataaaatacaggtccttgatacattggaaaacatttgcgcatacatgcattggct 156  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||    
27409180 tataaaatataggtccttgatacattgaaaaacatttgcgcatacatgcattggct 27409235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 153 - 223
Target Start/End: Complemental strand, 33421624 - 33421554
Alignment:
153 ggcttatccataacaataagccattgattgtaatcacaacccgggaaaagcggagccatctcagcaagagg 223  Q
    |||||||| |||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||    
33421624 ggcttatcaataataataagccagtgattgtaatcacaaccagggaaaagcggagccatctcagcaggagg 33421554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University