View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_147 (Length: 238)
Name: NF6131_low_147
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_147 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 8736256 - 8736471
Alignment:
| Q |
1 |
atggttgcttgctattatttcgatgatgggttttcacttatagcatgttattttcaagctagaatctaaatttctggtggacaatctagttgatgatggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8736256 |
atggttgcttgctattatttcgatgatgggttttcac-------atgttattttcaagctagaatctaaatttctggtggacaatctagttgatgatggg |
8736348 |
T |
|
| Q |
101 |
ttgtaattacattattgagtttggtgctcttacataaggttgtatagatttgcttggagtttcttttaaagcattcttacgagcaatttccaaaagatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || || |
|
|
| T |
8736349 |
ttgtaattacattattgagtttggtgctcttacataaggttgtatagatttgcttggagtttcttttaaagcattcttacgtgcaatttccaagagccag |
8736448 |
T |
|
| Q |
201 |
actaatgtaattgcttatattct |
223 |
Q |
| |
|
||||||||||||| | ||||||| |
|
|
| T |
8736449 |
actaatgtaattgttcatattct |
8736471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 93 - 136
Target Start/End: Original strand, 8712174 - 8712217
Alignment:
| Q |
93 |
atgatgggttgtaattacattattgagtttggtgctcttacata |
136 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
8712174 |
atgatggattgtaattacattattgaatttggtgctctgacata |
8712217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University