View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_156 (Length: 231)
Name: NF6131_low_156
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_156 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 33128857 - 33128676
Alignment:
| Q |
16 |
caaagggtccaactatataaacccagaatcccttgtagatgtgcatcactacagcaggcccaaaagttctggctgggttcattgatgcacctgacacagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33128857 |
caaagggtccaactatataaacccagaatcccttgtagatgtgcatcactacagcaggcccaaaagttctggctgggttcattgatgcacctgacacagg |
33128758 |
T |
 |
| Q |
116 |
actgcatgcaattatcaaacttaggattaaattgaagtagtatatatggacttcattatgataagtaaaaccattgaaactt |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33128757 |
actgcgtgcaattatcaaacttaggattaaattgaagtagtatatatggacttcattatgataagtaaaaccattgaaactt |
33128676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 115
Target Start/End: Original strand, 1703671 - 1703762
Alignment:
| Q |
24 |
ccaactatataaacccagaatcccttgtagatgtgcatcactacagcaggcccaaaagttctggctgggttcattgatgcacctgacacagg |
115 |
Q |
| |
|
||||||||||| | ||| ||||| ||||| || || ||||| | ||||| |||| | |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1703671 |
ccaactatatatatccacaatcctttgtaaatatgtatcacaattgcaggaccaatacttcttgctgggttcatagatgcacctgacacagg |
1703762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University