View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_165 (Length: 213)
Name: NF6131_low_165
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_165 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 28547230 - 28547181
Alignment:
| Q |
142 |
aattttcctcaatttgttatgaatatagtgatagaaaatgttaacatgta |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28547230 |
aattttcctcaatttgttatgaatatagtgatagaaaatgttaacatgta |
28547181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University