View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_167 (Length: 208)
Name: NF6131_low_167
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_167 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 812910 - 812723
Alignment:
| Q |
22 |
atccctttccccctt-atgaaactatttaatggggtggtgcggttgtgtagagtttgtttataattgactttcttagtaattcaaatttgnnnnnnngtg |
120 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
812910 |
atccctttcccccctcatgaaactatttaatggggtggtgcggttgtgcagagattgtttataattgactttcttagtaattcaattttttttttttgtg |
812811 |
T |
 |
| Q |
121 |
tacttttggggtattatattgtattgttttgttttcatgagacatgctttaaaatgtattatgagatgtatgtaaaatttaattaatt |
208 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
812810 |
tacttatggggtattgtattgtattgttttgttttcatgagatatgctttaaaatgtattatgagatgtatgtaaaatttaattaatt |
812723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University