View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_25 (Length: 487)
Name: NF6131_low_25
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 5e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 5e-91
Query Start/End: Original strand, 210 - 423
Target Start/End: Complemental strand, 36726691 - 36726478
Alignment:
| Q |
210 |
ggattttctactttgctttggtgaaaatacatgtttgggaaattccttgcatgctgagttgtctggagccatgagagcaatagagattgcaaactcacat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36726691 |
ggattttctactttgctttggtgaaaatacaggtttgggaaactccttgcatgtcgagttgtctggagccatgagaccaatagagattgcaaactcacat |
36726592 |
T |
|
| Q |
310 |
caatggtcgaatttatggctggaagtagattcaaaattggtgatcaaagccttcaaaaatgtttctttagttccttggaagcttagaaacagatggttaa |
409 |
Q |
| |
|
|| ||||||| ||||||||||||| ||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726591 |
cagcggtcgaaattatggctggaagcagattcagaattggtgatcaaagccttaaaaaatgtttctttagttccttggaagcttagaaacagatggttaa |
36726492 |
T |
|
| Q |
410 |
actgcgttcaattg |
423 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36726491 |
actgcgttcaattg |
36726478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 133 - 203
Target Start/End: Complemental strand, 22830686 - 22830616
Alignment:
| Q |
133 |
tggatcaaatgcaatacagatggattcacaaatggtaatctctcctcttgtggaggaattttcagagatag |
203 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||| || ||||||| ||||||||||||||| |||||||| |
|
|
| T |
22830686 |
tggatcaaatgcaacaccgatggatccacaaatggcaacctctccttttgtggaggaatttttagagatag |
22830616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 160 - 236
Target Start/End: Original strand, 23881422 - 23881498
Alignment:
| Q |
160 |
acaaatggtaatctctcctcttgtggaggaattttcagagatagtaaatcggattttctactttgctttggtgaaaa |
236 |
Q |
| |
|
|||||| |||||| || || ||||| ||||| |||||||||||||| ||||||||| | ||||||||||| ||||| |
|
|
| T |
23881422 |
acaaatagtaatcaatcttcctgtgggggaatcttcagagatagtaattcggattttttgctttgctttggagaaaa |
23881498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 203
Target Start/End: Original strand, 17688922 - 17688986
Alignment:
| Q |
139 |
aaatgcaatacagatggattcacaaatggtaatctc-tcctcttgtggaggaattttcagagatag |
203 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
17688922 |
aaatgcaatactgatggctccacaaatggta-tctcatcctcatgtggagggattttcagagatag |
17688986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 139 - 203
Target Start/End: Original strand, 23113677 - 23113741
Alignment:
| Q |
139 |
aaatgcaatacagatggattcacaaatggtaatctc-tcctcttgtggaggaattttcagagatag |
203 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||| ||||| |||||||| |||||||||||||| |
|
|
| T |
23113677 |
aaatgcaatactgatggctccacaaatggta-tctcatcctcatgtggagggattttcagagatag |
23113741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University