View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_39 (Length: 426)
Name: NF6131_low_39
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 216 - 357
Target Start/End: Complemental strand, 46309277 - 46309136
Alignment:
| Q |
216 |
tgatgatgaacatatgaataagaaaaagctaattgattttttggattttcacgataaacctaagaaaagaatgaggaaggctgaagaaaggcttatttgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46309277 |
tgatgatgaacatatgaataagaaaaagctaactgcttttttggattttcacgataaacctaagaaaagaatgaggaaggctgaagaaaggcttatttgt |
46309178 |
T |
 |
| Q |
316 |
acacctttgaagaaagactttttacaaaaataggatttcata |
357 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46309177 |
acacctttgaagaaaggctttttacaaaaataggatttcata |
46309136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 13 - 81
Target Start/End: Complemental strand, 46309476 - 46309408
Alignment:
| Q |
13 |
aacctgtgatggacttgtaaagttattagtgagatccatataataatattgacaaaattacttgagatg |
81 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||| | |||||| |
|
|
| T |
46309476 |
aaccagtgatggacttgtaaagttattagtgagatccataaaataatatcgacaaaattattcgagatg |
46309408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 165
Target Start/End: Complemental strand, 46309360 - 46309324
Alignment:
| Q |
129 |
ggagtccttcatcctaaaaaacatgcacaaataaata |
165 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46309360 |
ggagtccttaatcctaaaaaacatgcacaaataaata |
46309324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University