View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_73 (Length: 322)
Name: NF6131_low_73
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 47268223 - 47267917
Alignment:
| Q |
1 |
ttgagagtttggaggagtaacaacaaagatacaactttaacgattgtcgtctcttatcacacatccccaaacactttgtgtgaaaaaacccttacgcaac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47268223 |
ttgagagtttggaggagtaccaacaaagatacaactttaaagattgtcgtctcttatcacacatctccaaacactttgtgtgaaaaaacccttacgcaac |
47268124 |
T |
 |
| Q |
101 |
aagcacacaa--tcctcaaagtcatagccaaataaaccagttggtctctttaccctacaaccatctctacttcactgctccatcggttcatgccgaacca |
198 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47268123 |
aagcacacaaaattctcaaagtcatagccaaataaaccagttggtctctttaccctacaaccatctctacttcactgctccatcggttcatgccgaacca |
47268024 |
T |
 |
| Q |
199 |
cgttgaaggccacaaatttgagaatgttcccaaaactgcccggcgttaagtacaacatttattttaccattttaatcttttggtgcaccagtggactacg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47268023 |
cgttgaaggccacaaatttgagaatgttcctaaaactgcctggcgttaagtacaacatttattttaccattttaatcttttggtgcaccagtggactacg |
47267924 |
T |
 |
| Q |
299 |
ctcaaag |
305 |
Q |
| |
|
||||||| |
|
|
| T |
47267923 |
ctcaaag |
47267917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University