View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_89 (Length: 295)
Name: NF6131_low_89
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_89 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 11 - 295
Target Start/End: Complemental strand, 26455329 - 26455045
Alignment:
| Q |
11 |
cataggaagttttggagctggatgcctatagaacttttatggtcaaccacaaccctatggcttcccaattcgtgactctcaccaagaagttaaactgaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26455329 |
cataggaagttttggagctggatgcctatagaacttttatggtcaaccacaaccctatggcttcccaattcgtgactctcaccaagaagttaaactgaag |
26455230 |
T |
 |
| Q |
111 |
atgcaactgaggaagccattgttccaagtcacaacaaacaaaagtatggaagtgtaattatgggaaatagaacaaggaaggcattgttgaagatacaact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26455229 |
atgcaactgaggaagccattgttccaagtcacaacaaacaaaagtatggaagtgtaattatgggaaatagaacaagtaaggcattgttgaagatacaact |
26455130 |
T |
 |
| Q |
211 |
gaggaagccaactacgtggtgattacaagagaggcaacccattttttaactcctaccttaatgcaagaaaaaatcatcataatat |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
26455129 |
gaggaagccaactacgtggtgattacaagagaggcaacccattttttaacacctacattaatgcaagaaaaaatcatcataatat |
26455045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University