View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6131_low_99 (Length: 279)
Name: NF6131_low_99
Description: NF6131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6131_low_99 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 9 - 185
Target Start/End: Complemental strand, 28723902 - 28723740
Alignment:
| Q |
9 |
gagaagaacttagccggtagag-gaggtgtttgcaattactactgagaaagaagatagaaagagtggagattgtagcaaaatgctgagaagagtttttca |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
28723902 |
gagaagaacttagccggtagagagaggtgtttacaattactactgagaaagaagat---------------tgtagcaaaatgctgagaagagttgttca |
28723818 |
T |
 |
| Q |
108 |
aaaatctcttcggacatttcatcgtcccatcacagccgcatcatgccattactcttcttctacaatctctatcgaccg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28723817 |
aaaatctcttcggacatttcatcgtcccatcacagccgcatcatgccattactcttcttctacaatctccatcgaccg |
28723740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University