View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6132_high_32 (Length: 239)
Name: NF6132_high_32
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6132_high_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 26687299 - 26687495
Alignment:
| Q |
1 |
tttagacaaaaatagaagagacaatacggaataatctagagggaaaatatgagggggaaaacgagacataacaatataacatatagagaaagatcaacga |
100 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26687299 |
tttagacaaaagtagaagagacaatatggaaaaatctagagggaaaatatgagggggaaaacgagacataacaatataacatatagagaaagatcaacga |
26687398 |
T |
|
| Q |
101 |
ttttcaattccaacgtctattgaacatccattacacgggcagactgcatgttatcccccgtgattttatgttatgttt-aaatataataacattatg |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
26687399 |
ttttcaattccaacgtctattgagcatccgttacacgggcagactgtatgttatcccccgtgattttatgctatgtttaaaatataataacattatg |
26687495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 26957030 - 26957226
Alignment:
| Q |
1 |
tttagacaaaaatagaagagacaatacggaataatctagagggaaaatatgagggggaaaacgagacataacaatataacatatagagaaagatcaacga |
100 |
Q |
| |
|
||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26957030 |
tttagacaaaagtagaagagacaatatggaaaaatctagagggaaaatatgagggggaaaacgagacataacaatataacatatagagaaagatcaacga |
26957129 |
T |
|
| Q |
101 |
ttttcaattccaacgtctattgaacatccattacacgggcagactgcatgttatcccccgtgattttatgttatgttt-aaatataataacattatg |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
26957130 |
ttttcaattccaacgtctattgagcatccgttacacgggcagactgtatgttatcccccgtgattttatgctatgtttaaaatataataacattatg |
26957226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University