View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6132_low_39 (Length: 238)
Name: NF6132_low_39
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6132_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 13 - 230
Target Start/End: Original strand, 4663271 - 4663487
Alignment:
| Q |
13 |
catcaaaaggagaggggtatacttgggggtctaatgtaatgaagacttcaaacatttatgcaa-tgtaacatgcccattttcatgtttgtcaaacataaa |
111 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4663271 |
catcaaaaggagagaggtatacttgggggtctaatgtaatgaagacttcaaacatttatgcaaatgtaacatgcccattttcatgtttgtcaaacataaa |
4663370 |
T |
 |
| Q |
112 |
atctgttgtgttattatattttgtctaaggaatgtgtatcaaattgcaggctcttcttttcttgttagctcttattgttagggctgtaaataggcccgca |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
4663371 |
atctgttgtgttattatatt--gtctaaggaatgtgtatcgaattgcaggctcttcttttcttgttagcccttattgttagggctgtaaataggccagca |
4663468 |
T |
 |
| Q |
212 |
gattatgatagtgatgatg |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
4663469 |
gattatgatagtgatgatg |
4663487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 153 - 228
Target Start/End: Complemental strand, 40785628 - 40785553
Alignment:
| Q |
153 |
aattgcaggctcttcttttcttgttagctcttattgttagggctgtaaataggcccgcagattatgatagtgatga |
228 |
Q |
| |
|
||||| |||| ||||||||| | ||||| |||||||| |||||| ||||||||| | |||||| ||||||||||| |
|
|
| T |
40785628 |
aattgtaggcacttcttttcatcttagcccttattgtccgggctgcaaataggccagtagattacgatagtgatga |
40785553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University