View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6132_low_44 (Length: 230)
Name: NF6132_low_44
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6132_low_44 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 216
Target Start/End: Complemental strand, 3843126 - 3842930
Alignment:
| Q |
20 |
tctaagtttggttcttaatcttaagttaaaacattcaagcctacaacttgaaagttaagaaggatcaagaaaaatatcatctcccaccctttaaactagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843126 |
tctaagtttggttcttaatcttaagttaaaacattcaagcctacaacttgaaagttaagaaggatcaagaaaaatatcatctcccaccctttaaactagg |
3843027 |
T |
 |
| Q |
120 |
gtttagaatttagttatgaggtatatcttaaacaatttttaggatttgttgcttgagttagaacctatcaactatgagttatttatatatataaaca |
216 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3843026 |
gtatagaatttagttatgaggtatatcttaaacaatttttaggatttgttgcttgagttagaacctatcaactatgagttatttatatatataaaca |
3842930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University