View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6132_low_45 (Length: 229)
Name: NF6132_low_45
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6132_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 33222836 - 33223036
Alignment:
| Q |
12 |
gagatgaataata--ccatcttattaagaacatagttagttgagattgttttgaagaaatttttaggaagagatgtataccatgttactatcaaggggct |
109 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
33222836 |
gagatgaataatataccatcttattaagaacatagttagttgagattgttttgaagaagtttttaggaagagatatataccatcttactatcaaggggct |
33222935 |
T |
 |
| Q |
110 |
acatnnnnnnnnntccaaaaggttgaaccaaccctaagtgtggatgactatttaaggacttcgagactttgagaattcacttcaaaattagtgagaatga |
209 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33222936 |
acataaaaaaaa-tccaaaaggttgaaccaaccctaagtgtggatgactatttaaggacttcgagactttgagaattcacttcaaaattagcgagaatga |
33223034 |
T |
 |
| Q |
210 |
ag |
211 |
Q |
| |
|
|| |
|
|
| T |
33223035 |
ag |
33223036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University