View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6132_low_45 (Length: 229)

Name: NF6132_low_45
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6132_low_45
NF6132_low_45
[»] chr2 (1 HSPs)
chr2 (12-211)||(33222836-33223036)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 211
Target Start/End: Original strand, 33222836 - 33223036
Alignment:
12 gagatgaataata--ccatcttattaagaacatagttagttgagattgttttgaagaaatttttaggaagagatgtataccatgttactatcaaggggct 109  Q
    |||||||||||||  ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||    
33222836 gagatgaataatataccatcttattaagaacatagttagttgagattgttttgaagaagtttttaggaagagatatataccatcttactatcaaggggct 33222935  T
110 acatnnnnnnnnntccaaaaggttgaaccaaccctaagtgtggatgactatttaaggacttcgagactttgagaattcacttcaaaattagtgagaatga 209  Q
    ||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33222936 acataaaaaaaa-tccaaaaggttgaaccaaccctaagtgtggatgactatttaaggacttcgagactttgagaattcacttcaaaattagcgagaatga 33223034  T
210 ag 211  Q
    ||    
33223035 ag 33223036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University