View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6132_low_48 (Length: 214)
Name: NF6132_low_48
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6132_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 28923468 - 28923283
Alignment:
| Q |
13 |
atcaaatcaatggccactatgtatgaaataaaactctctgtttttacaattcacttttctaccatttttgtttctaataactaacactcttcttctctct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28923468 |
atcaaatcaatggccactatgtatgaaataaaactctctgtttttacaattcacttttctaccatttttgtttctaataactaacactcttcttctctct |
28923369 |
T |
 |
| Q |
113 |
ttctaattaccagtggtgtcaaaccagttctccctcctccgttaacttcaacttcacaaccaccacctctttttgatggaaccacc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28923368 |
ttctaattaccagtggtgtcaaaccagttctccctcctccgttaacttcaacttcacaaccaccacctctttttgatggaaccacc |
28923283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 152 - 197
Target Start/End: Complemental strand, 28910896 - 28910851
Alignment:
| Q |
152 |
cgttaacttcaacttcacaaccaccacctctttttgatggaaccac |
197 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
28910896 |
cgttaacttcaacttcggaacaaccacctctttttgatggaaccac |
28910851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University