View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6132_low_49 (Length: 211)
Name: NF6132_low_49
Description: NF6132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6132_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 44946514 - 44946338
Alignment:
| Q |
15 |
cacagatagatattccaattccaaccttaattgggaggcatggacaacaacgagcatcttgagtatgtgtttgtgccattgggattattggtgttctttt |
114 |
Q |
| |
|
|||| ||| ||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44946514 |
cacaaatatatattccaattagaaccttaattgggagacatggggaacaacgagcatcttgagtatgtgtttgtgccattgggattattggtgttctttt |
44946415 |
T |
|
| Q |
115 |
tgtaccatgcttggcttctcttcactattcttcgtgaacctcatcgaactgtcatcggcttaaacgcagagtctcgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
44946414 |
tgtaccatgcttggcttctcttcactattcttcgtgaacctcatcgaactgtcattggcttaaacgctgagtctcgt |
44946338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University