View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6133_low_2 (Length: 328)
Name: NF6133_low_2
Description: NF6133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6133_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 9 - 313
Target Start/End: Original strand, 28195635 - 28195939
Alignment:
| Q |
9 |
acatcatcactgccaccacggctaagatcctctaaatttccgcgtttctttatagaacatctaggagctctatccttcgatttgatcgcttttttcttct |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28195635 |
acatcatcactgccaccacggctaagatcctctaaatttccgcgtttctttatagaacatctaggagctctatccttcgatttgatagcttttttcttct |
28195734 |
T |
|
| Q |
109 |
tcttttcattaacatcaccatcaccctcacccatttcattttgttggtctaannnnnnnnctcccttaacctcgccttttgcacaagaattcgacttcct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28195735 |
tcttttcattaacatcaccatcaccctcacccatttcattttgttggtctaattttttttttcccttaacctcgccttttgcactagaattcgacttcct |
28195834 |
T |
|
| Q |
209 |
ctttatcgtttccttcttgcgatcaattttcttcacatctgctgcaacaacattgccggagtcactttcatggcttgcatcgaccttcggcatcatggat |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28195835 |
ctttatcgtttccttcttgcgatcaattttcttcacatctgctgcaacaacattgccggagtcactttcatggcttgcatcgaccttcggcatcatggat |
28195934 |
T |
|
| Q |
309 |
gatgg |
313 |
Q |
| |
|
||||| |
|
|
| T |
28195935 |
gatgg |
28195939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University