View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6134_high_10 (Length: 246)
Name: NF6134_high_10
Description: NF6134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6134_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 2829702 - 2829923
Alignment:
| Q |
22 |
aacaacctatgtcttcatatcattgatgctggaatagttacctcaagcatttttattttctctctcagacttgccatttcttttgaatgatgaggactgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829702 |
aacaacctatgtcttcatatcattgatgctagaatagttacctcaagcatttttattttctctctcagacttgccatttcttttgaatgatgaggactgg |
2829801 |
T |
|
| Q |
122 |
aagcaannnnnnngttgattgggatggttttagatccatcagaaagttggttgcgtccgttactatccctgaatctcttctcaatgctggttaatgcatc |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829802 |
aagcaatttttttgttgattgggatggttttagatccatcagaaagttggttgcgtccgttactatccctgaatctcttctcaatgctggttaatgcatc |
2829901 |
T |
|
| Q |
222 |
acctttcttcttcatttcactc |
243 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
2829902 |
acctttcttctttatttcactc |
2829923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 126
Target Start/End: Complemental strand, 40800725 - 40800658
Alignment:
| Q |
59 |
ttacctcaagcatttttattttctctctcagacttgccatttcttttgaatgatgaggactggaagca |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||| || | ||||||| | |||||| |
|
|
| T |
40800725 |
ttacctcaagcatttttattttctctctcagatctgtcatttctttggagttatgaggaattgaagca |
40800658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University