View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6134_high_7 (Length: 274)
Name: NF6134_high_7
Description: NF6134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6134_high_7 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 37 - 274
Target Start/End: Complemental strand, 2829693 - 2829456
Alignment:
| Q |
37 |
aagaaaatttattgctccctggatgctgttttctcttgtaatatttcagaacatatactatatatccttcattttctccttcttatgttaatataaaaga |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829693 |
aagaaaatttattgctccctggatgctgttttctcttgtaatatttcagaacatatactatatatccttcattttctccttcttatgttaatataaaaga |
2829594 |
T |
 |
| Q |
137 |
ttgtttatgtcagggcctgataaagtcaaaggaaactgccttggaaacttcaacaacttcatctatgaagaaggaaaaggaacttcagagcagaattgtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829593 |
ttgtttatgtcagggcctgataaagtcaaaggaaactgccttggaaacttcaacaacttcatctatgaagaaggaaaaggaacttcagagcagaattgtg |
2829494 |
T |
 |
| Q |
237 |
gagctggagaacaaagtggaggaatttaatcagaatgt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829493 |
gagctggagaacaaagtggaggaatttaatcagaatgt |
2829456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University