View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6134_low_14 (Length: 235)
Name: NF6134_low_14
Description: NF6134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6134_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 2306615 - 2306829
Alignment:
| Q |
10 |
gggaattaagtcaaacaagagagaaattattggcatttggtctaataggacaacaattttgtctttgaatagcttttactcttttaaactaggactagga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2306615 |
gggaattaagtcaaacaagagagaaattattggcatttggtctaataggacaacaattttgtctttgaatagcttttactcttttaaactaggactagga |
2306714 |
T |
 |
| Q |
110 |
tttagcggaatttctattttttaccctaatacgaaacaaaactacctgtcaaacttagtatgagatttatttacacaaataatttattttaagaagc--a |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || | |
|
|
| T |
2306715 |
tttagcggaatttctattttttaccctaatatgaaacaaaactacctgtcaaacttagtatgagatttatttacataaataatttattttaagaggcaaa |
2306814 |
T |
 |
| Q |
208 |
aatgaaattatatat |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2306815 |
aatgaaattatatat |
2306829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University