View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6134_low_8 (Length: 272)
Name: NF6134_low_8
Description: NF6134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6134_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 2829476 - 2829223
Alignment:
| Q |
1 |
ggaggaatttaatcagaatgttactttacacgaggtaaactaacgctataactatttgcaaaagcatttttgttccacgaaacctgaattagaaactttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2829476 |
ggaggaatttaatcagaatgttactttacacgaggtaaactaacgctataactatttgcaaaagcatttttgttccacaaaacctgaattagaaactttg |
2829377 |
T |
|
| Q |
101 |
tcttgcttagttcaaactttcattgttgaaatgtggattgataatgaagcaattgaattacatatcttcaataaattgacattaacatgcccttcaaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829376 |
tcttgcttagttcaaactttcattgttgaaatgtggattgataatgaagcaattgaattacatatcttcaataaattgacattaacatgcccttcaaatt |
2829277 |
T |
|
| Q |
201 |
ggttgttcaggatagaagtattaaaagttcaaatgagatatcggaaaaagtaag |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2829276 |
ggttgttcaggatagaagtattaaaagttcaaatgagatatcggaaaaagtaag |
2829223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University