View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6135_high_13 (Length: 266)
Name: NF6135_high_13
Description: NF6135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6135_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 31523485 - 31523367
Alignment:
| Q |
1 |
tttcttttttaccaaaattttcttcttgaatgtttgaagcgattcaagttaatttgttatgttctcttcatactact--------agaactagaaggaaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31523485 |
tttcttttttaccaaaattttcttcttgaatgtttgaagcgattcaagttaatttgttatgttctcttcatactactagaagtctagaactagaaggaaa |
31523386 |
T |
 |
| Q |
93 |
ctgataagacattgtttta |
111 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
31523385 |
ctgttaagacattgtttta |
31523367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 210
Target Start/End: Original strand, 40976157 - 40976186
Alignment:
| Q |
181 |
tgtttaaatcaatcttgattcgtcaatttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40976157 |
tgtttaaatcaatcttgattcgtcaatttg |
40976186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University