View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6135_low_11 (Length: 310)
Name: NF6135_low_11
Description: NF6135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6135_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 14 - 134
Target Start/End: Original strand, 28062885 - 28063007
Alignment:
| Q |
14 |
tatgtggtgaagtttgattacgtgctcgttttgcttcgtagaagtgatttcttgctcttcacggaaaaattagacaaag--ttttgtttggttactaaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
28062885 |
tatgtggtgaagtttgattacgtgctcgttttgcttagtagaagtgatttcttgctcttcacggaaaaattagactaagttttttgtttggttactaaaa |
28062984 |
T |
 |
| Q |
112 |
ttagagcaagtttaactttaaga |
134 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
28062985 |
ttagagtaagtttaactttaaga |
28063007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 199 - 302
Target Start/End: Original strand, 28063072 - 28063175
Alignment:
| Q |
199 |
ggtgcagtggtaaaaagccagcatatcttggagtacagaataatccaccatcactggcactgtgtccattaacaaagaactgcatttcaacctctgatga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28063072 |
ggtgcagtggtaaaaagccagcatatcttggagtacagaataatccaccatcactggcactgtgtccattaacaaagaactgcatttcaacctctgaaga |
28063171 |
T |
 |
| Q |
299 |
tgtc |
302 |
Q |
| |
|
|||| |
|
|
| T |
28063172 |
tgtc |
28063175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University