View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6135_low_14 (Length: 266)

Name: NF6135_low_14
Description: NF6135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6135_low_14
NF6135_low_14
[»] chr7 (1 HSPs)
chr7 (1-111)||(31523367-31523485)
[»] chr1 (1 HSPs)
chr1 (181-210)||(40976157-40976186)


Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 31523485 - 31523367
Alignment:
1 tttcttttttaccaaaattttcttcttgaatgtttgaagcgattcaagttaatttgttatgttctcttcatactact--------agaactagaaggaaa 92  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |||||||||||||||    
31523485 tttcttttttaccaaaattttcttcttgaatgtttgaagcgattcaagttaatttgttatgttctcttcatactactagaagtctagaactagaaggaaa 31523386  T
93 ctgataagacattgtttta 111  Q
    ||| |||||||||||||||    
31523385 ctgttaagacattgtttta 31523367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 181 - 210
Target Start/End: Original strand, 40976157 - 40976186
Alignment:
181 tgtttaaatcaatcttgattcgtcaatttg 210  Q
    ||||||||||||||||||||||||||||||    
40976157 tgtttaaatcaatcttgattcgtcaatttg 40976186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University