View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6135_low_6 (Length: 392)
Name: NF6135_low_6
Description: NF6135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6135_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 164 - 389
Target Start/End: Original strand, 33973991 - 33974216
Alignment:
| Q |
164 |
aattacaaaagtgtcgcttgttttgagacatagttttaaattgtgtttaatttgcaaactttgatattgcgagaaatagtagggaaatgcagctgatgca |
263 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33973991 |
aattacaaaagtgtcacttgttttgagacatagttttaaattgtgtttaatttgcaaactttgatattgcgagaaatagtagggaaatgcagctgatgca |
33974090 |
T |
|
| Q |
264 |
gccgcaattgcagttgtgataccgttgcagggggctctaaaacctttattttacagccgcgattgcagttgcagactgcaaattaaaaccatggttttag |
363 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33974091 |
gccgcaattgcagttgtgataccgttgccgggggctctaaaacctttattttacagccgcgattgcagttgcagactgcaaattaaaaccatggttttag |
33974190 |
T |
|
| Q |
364 |
acttgtttttccgtgtcctatgctac |
389 |
Q |
| |
|
||||||||||||||||| | |||||| |
|
|
| T |
33974191 |
acttgtttttccgtgtcttttgctac |
33974216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 15 - 96
Target Start/End: Original strand, 33973842 - 33973923
Alignment:
| Q |
15 |
catagttgttaattagaaaagggtttattcgaattttgaagttgtatttgtttctgctacagaatcaactattaggttaagc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33973842 |
catagttgttaattagaaaagggtttattcgaattttgaagttgtatttgtttctgcaacagaatcaactattaggttaagc |
33973923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University