View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6135_low_9 (Length: 320)
Name: NF6135_low_9
Description: NF6135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6135_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 28363089 - 28363375
Alignment:
| Q |
19 |
ccgatgtcgttggacatttgtggagtctttgccagaatgaacgaacacactcttcacaatcttacattttgcttttcacaacagttattcgtaacattgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28363089 |
ccgatgtcgttggacatttgtggagtctttgccagaatgaacgaacacactcttcacaatcttacattttgcttttcacaacagttattcgtaacattgt |
28363188 |
T |
 |
| Q |
119 |
tgataagaaactcagtgtttcaattctcaatacatcgcttccgatgcttcctttcaatacaccgcaatgcgtgaatcgggaggaatttggtttgggtttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28363189 |
tgataagaaactcagtgtttcaattctcaatacatcgcttccgatgcttcctttcaatacaccgcaatgcgtgaatcgggaggaatttggtttgggtttg |
28363288 |
T |
 |
| Q |
219 |
aatacgaaggaattaaggagggcattggcgtttttgttggagtggccacaagtgttgacaccatgtggaatgatggagtttgtgtct |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28363289 |
aatacgaaggaattaaggagggcattggcgtttttgttggagtggccacaagtgttgacaccatgtggaatgatggagtttgtgtct |
28363375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University