View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6136_high_13 (Length: 304)
Name: NF6136_high_13
Description: NF6136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6136_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 27 - 121
Target Start/End: Complemental strand, 32866859 - 32866765
Alignment:
| Q |
27 |
gcatttgatagattacataacaaaataaaataatttgagcatacacgtataaaattatatatcaattatttatttttaaaactagcatattctaa |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32866859 |
gcatttgatagattacataacaaaataaaataatttgagcatacacgtataaaattatatatcaattatttatttttaaaactagcagattctaa |
32866765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 145 - 202
Target Start/End: Complemental strand, 32866741 - 32866684
Alignment:
| Q |
145 |
gattgtttgtctaaatcgtgaccatccaaaactttattgcgaccaaatcgtgttttat |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||| |||||||| |
|
|
| T |
32866741 |
gattgtttgtctaaatcgtgaccattcaaaactttattgtgaccaaattatgttttat |
32866684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University