View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6136_low_17 (Length: 278)
Name: NF6136_low_17
Description: NF6136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6136_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 268
Target Start/End: Complemental strand, 14880108 - 14879835
Alignment:
| Q |
1 |
gacaagttttaaacataaacaacatattatgaacactaacaatggtattaggatgaaaatttgacataggaatataacaattattagaaacacaagaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14880108 |
gacaagttttaaacataaacaacatattatgaacactaacaatggtattaggatgaaaatttgacataggaatataacaattattagaaacacaagaaca |
14880009 |
T |
 |
| Q |
101 |
tgcatatgaaacacaagaacatagcaaccatttaaaaatg------nnnnnnnnnagaaatagaaatataagtagaaaagacaatccaagtcggtaaagc |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14880008 |
tgcatatgaaacacaagaacatagcaaccatttaaaaatgattttttttatttttagaaatagaaatataagtagaaaagacaatccaagtcggtaaagc |
14879909 |
T |
 |
| Q |
195 |
aaaacatcaagtcgggttttgaaacgaaagataaccatcttaggtatctttgatttctctcccattatcctttg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14879908 |
aaaacatcaagtcgggttttgaaacgaaagataaccatcttaggtatctttgatttctcttccattctcctttg |
14879835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University