View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6136_low_19 (Length: 269)
Name: NF6136_low_19
Description: NF6136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6136_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 23 - 258
Target Start/End: Complemental strand, 11433937 - 11433702
Alignment:
| Q |
23 |
ggcggagaggtcgattgtggggatttccggttgggagaaatctgatcgtggagtgaggtcagatagggtttcaggtggatggatgaagaaagatggaatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11433937 |
ggcggagaggtcgattgtggggattttcggttgggggaaatctgatcgtggagtgaggtcagatagggtttcaggtggatggatgaagaaagatggaatg |
11433838 |
T |
|
| Q |
123 |
gttttgattccggagtcgattaagccttttacgccggattttgtttcgtcaaattctttcacggctcttacacggtcgtacggtgttgatgaaacggtgg |
222 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||| | ||||||||||| |||| |||||| ||||||| |
|
|
| T |
11433837 |
gttttgattccggagtcgattatgccttttacgccggattttgtttcgtcgaattctttcaaggctttcacacggtcgtagggtggtgatgagacggtgg |
11433738 |
T |
|
| Q |
223 |
ttggtggtggagaaggggtggcaattggtgatgatg |
258 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11433737 |
ttggtggtagagaaggggtggcaattggtgatgatg |
11433702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 23 - 258
Target Start/End: Complemental strand, 11423312 - 11423077
Alignment:
| Q |
23 |
ggcggagaggtcgattgtggggatttccggttgggagaaatctgatcgtggagtgaggtcagatagggtttcaggtggatggatgaagaaagatggaatg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11423312 |
ggcggagaggtcgattgtggggatttccggttgggggaaatctgatcgtggagtgaggtcagataggatttcaggtggatggatgaagaaagatggaatg |
11423213 |
T |
|
| Q |
123 |
gttttgattccggagtcgattaagccttttacgccggattttgtttcgtcaaattctttcacggctcttacacggtcgtacggtgttgatgaaacggtgg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | | || |||||||||| |||||| ||||||| |
|
|
| T |
11423212 |
gttttgattccggagtcgattaagccttttacgccggattttgtttcgtcgaattctttcacggctttgattcgatcgtacggtggtgatgagacggtgg |
11423113 |
T |
|
| Q |
223 |
ttggtggtggagaaggggtggcaattggtgatgatg |
258 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
11423112 |
ttggtggtggtgaaggagtggcaattggtgatgatg |
11423077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 21 - 184
Target Start/End: Complemental strand, 11428061 - 11427898
Alignment:
| Q |
21 |
atggcggagaggtcgattgtggggatttccggttgggagaaatctgatcgtggagtgaggtcagatagggtttcaggtggatggatgaagaaagatggaa |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| || ||||| ||||| ||||| || || ||||||||||||| |
|
|
| T |
11428061 |
atggcggagaggtcgattgtgggaatttctggttgggggaaatctgatcgtggagtgagatcggatagagtttcgggtgggtgaataaagaaagatggaa |
11427962 |
T |
|
| Q |
121 |
tggttttgattccggagtcgattaagccttttacgccggattttgtttcgtcaaattctttcac |
184 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||| || ||||||||||| |
|
|
| T |
11427961 |
tggttttgattccgaagtcgattaagccttttacgtcggattttgtttcatcgaattctttcac |
11427898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 27 - 199
Target Start/End: Original strand, 11390246 - 11390418
Alignment:
| Q |
27 |
gagaggtcgattgtggggatttccggttgggagaaatctgatcgtggagtgaggtcagatagggtttcaggtggatggatgaagaaagatggaatggttt |
126 |
Q |
| |
|
||||||||||| ||||| ||||||||||||| |||||||||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
11390246 |
gagaggtcgatggtgggaatttccggttgggggaaatctgatcgtggagtgaggtcggatagagtttcgggtggatggatgaagaatgatgggatggttt |
11390345 |
T |
|
| Q |
127 |
tgattccggagtcgattaagccttttacgccggattttgtttcgtcaaattctttcacggctcttacacggtc |
199 |
Q |
| |
|
||||||||||||| ||| ||||||||| || |||| ||||| || ||||||||||| ||| | |||||||| |
|
|
| T |
11390346 |
tgattccggagtctgttaggccttttacacctaatttggtttcatcgaattctttcaccgctttaacacggtc |
11390418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 9308637 - 9308696
Alignment:
| Q |
19 |
ggatggcggagaggtcgattgtggggatttccggttgggagaaatctgatcgtggagtgag |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || ||||||||||| ||||||||| |
|
|
| T |
9308637 |
ggatggcggagaggtcgattgtggggatttccagttagg-gaaatctgatcttggagtgag |
9308696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University