View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6136_low_23 (Length: 251)
Name: NF6136_low_23
Description: NF6136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6136_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 50422796 - 50423033
Alignment:
| Q |
1 |
tttggcaccgtagctatagttgacgatccagtaaccgagggacctacaatggattcaaaactcatcggtagagctcaaggcacgtacataaattcgcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50422796 |
tttggcaccgtagctatagttgacgatccagtaaccgagggacctacaatggattcaaaactcatcggtagagctcaaggcacgtacataaattcgcagc |
50422895 |
T |
 |
| Q |
101 |
ttgatggtaaagctttgtacatggttttctcggtgatattcacagctggtgagtatagaggaagcaccttggagattcaaggatctgatatattcacaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50422896 |
ttgatggtaaagctttgtacatggttttctcggtgatattcacagctggtgagtatagaggaagcaccttggagattcaaggatctgatatattcacaac |
50422995 |
T |
 |
| Q |
201 |
gaaggaacgagaatttggaattgtttcaggcacaggtt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50422996 |
gaaggaacgagaatttggaattgtttcaggcacaggtt |
50423033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 4 - 238
Target Start/End: Original strand, 50427972 - 50428206
Alignment:
| Q |
4 |
ggcaccgtagctatagttgacgatccagtaaccgagggacctacaatggattcaaaactcatcggtagagctcaaggcacgtacataaattcgcagcttg |
103 |
Q |
| |
|
|||||||| || ||| | || ||||||||||| |||||||| |||||||||||| |||| | || || ||||| ||| |||| ||||||||||||||| |
|
|
| T |
50427972 |
ggcaccgtggcaataatcgatgatccagtaacagagggacccgcaatggattcaacactccttggcagtgctcagggcgtgtacgtaaattcgcagcttg |
50428071 |
T |
 |
| Q |
104 |
atggtaaagctttgtacatggttttctcggtgatattcacagctggtgagtatagaggaagcaccttggagattcaaggatctgatatattcacaacgaa |
203 |
Q |
| |
|
|| | ||||| |||||||||||||||| ||||||||||| ||||| |||| | ||||||||| |||||||| ||||||| | | ||| ||||| || |
|
|
| T |
50428072 |
atagcaaagcagtgtacatggttttctcagtgatattcacttctggtaagtacataggaagcacattggagatgcaaggatatagtttatatacaacaaa |
50428171 |
T |
 |
| Q |
204 |
ggaacgagaatttggaattgtttcaggcacaggtt |
238 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||| |
|
|
| T |
50428172 |
ggaaagagaatttgggattgtttctggcacaggtt |
50428206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University