View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6136_low_25 (Length: 247)
Name: NF6136_low_25
Description: NF6136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6136_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 366090 - 366216
Alignment:
| Q |
1 |
atgaaggtgttgtatgtaatgagagacatgtatgtaatataatgaggttgaggggaagaattggtttgtaagaatgagaagaatttgaagtcttactgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
366090 |
atgaaggtgttgtatgtaatgagagacatgcatgtaatgtaatgaggttgaggggaagaattggtttgtaagaatgagaagaatttgaagtcttactgag |
366189 |
T |
|
| Q |
101 |
gagtggtgttgatgatgttgcttcttc |
127 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
366190 |
gagtggtgttgatgatgttgcttcttc |
366216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 195 - 234
Target Start/End: Original strand, 366284 - 366323
Alignment:
| Q |
195 |
cggtatgattcttagatctatttagaattcatttgtgttc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
366284 |
cggtatgattcttagatctatttagaattcatttgtgttc |
366323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University