View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6136_low_9 (Length: 367)
Name: NF6136_low_9
Description: NF6136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6136_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 20 - 352
Target Start/End: Original strand, 55910607 - 55910939
Alignment:
| Q |
20 |
tcttattttagcaggtgtatcagggagtaaaagtttgacagctttattctcgtgtctaggacccatgttttccttgcttaattatgcaggttgtgggtgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910607 |
tcttattttagcaggtgtatcagggagtaaaagtttgacagctttattctcgtgtctaggacccatgttttccttgcttaattatgcaggttgtgggtgg |
55910706 |
T |
 |
| Q |
120 |
ggcgtgactggcattttgttcttagttttgattgtgcagttttgtttcataggatctttcttgctatgttagtttgtggctggattgagttttctttgcc |
219 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910707 |
ggcgtgattggcattttgttcttagttttgattgtgcagttttgtttcataggatctttcttgctatgttagtttgtggctggattgagttttctttgcc |
55910806 |
T |
 |
| Q |
220 |
acatccttttaatcgaatattgttactttccctagcnnnnnnnnccgctatgattatttttgtagatctgttattgctccaaactgctgaatcaaataaa |
319 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55910807 |
acatccttttaatcgaatattgttacttttcctagcttttttttccgctatgattatttttgtagatctgttattgctccaaactgctgaatcaaataaa |
55910906 |
T |
 |
| Q |
320 |
gatatattcacacctgatatcacagtgttcagt |
352 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
55910907 |
gatatattcacacctgatatcacagtattcagt |
55910939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University