View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6137_high_7 (Length: 319)
Name: NF6137_high_7
Description: NF6137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6137_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 286
Target Start/End: Original strand, 37340792 - 37341070
Alignment:
| Q |
14 |
gaaggtccaactatgtatgtgaaatgtgaactacaattggctaaataatgatatatttttggtcaactggattattaattatatgattagcattgtcaac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340792 |
gaaggtccaactatgtatgtgaaatgtgaactacaattggctaaataatgatatttttttggtcaactggattattaattatatgattagcattgtcaac |
37340891 |
T |
 |
| Q |
114 |
cagcctcacatgtcaaaaaacaatctagtacaacataccatgtgctttcatgcttgtttcctgtctttcttttagccctttct------ttagtcttgca |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37340892 |
cagcctcacatgtcaaaaaacaatctagtacaacataccatgtgctttcatgcttatttcctgtctttcttttagccctttctttagtcttagtcttgca |
37340991 |
T |
 |
| Q |
208 |
gatctgatattaactttgcgccttgtggctaaactatatccatgtcatatggcaaccatttattcatctccccccaagc |
286 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340992 |
ggtctgatattaactttgcgccttgtggctaaactatatccatgtcatatggcaaccatttattcatctccccccaagc |
37341070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 319
Target Start/End: Complemental strand, 44989984 - 44989947
Alignment:
| Q |
282 |
caagcattccaagcaaataattcttattaagagcaaca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44989984 |
caagcattccaagcaaataattcttattaagagcaaca |
44989947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University