View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6138_high_3 (Length: 249)
Name: NF6138_high_3
Description: NF6138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6138_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 114 - 240
Target Start/End: Original strand, 3105922 - 3106046
Alignment:
| Q |
114 |
aatatggaccgacgtcggatgaaagaccgttcacgctttgatgacccatattcacaaagcagcggcacttagagattaacaacctccatcttccaattag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3105922 |
aatatggaccgacgtcggatgaaagaccgttca-gctttgatgacc-atattctcaaagcagcggcacttagagattaacaacctccatcttccaattag |
3106019 |
T |
|
| Q |
214 |
tgagatgacaatgagacctgatgatgt |
240 |
Q |
| |
|
|||||||||||||| |||||||||||| |
|
|
| T |
3106020 |
tgagatgacaatgaaacctgatgatgt |
3106046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 80
Target Start/End: Original strand, 3105322 - 3105384
Alignment:
| Q |
18 |
taataacattcttttgaatactacttcatgtagctatttacatatataatttacatcaaatca |
80 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3105322 |
taataacatttttttgaatactacttcatgtagctattgacatatataatttacatcaaatca |
3105384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University