View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6139_high_5 (Length: 314)
Name: NF6139_high_5
Description: NF6139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6139_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 71 - 297
Target Start/End: Original strand, 22314133 - 22314359
Alignment:
| Q |
71 |
tgtttcccacatatggcaaatggtcaagattcacattttttaatctcatttatcggagacaaaatatgtttgctagtgttcgctcagatcgactataggt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22314133 |
tgtttcccacatatggcaaatggtcaagattcacattttttaatctcacttattggagaaaaaatatgtttgctagtgttcgctcagatcgactataggt |
22314232 |
T |
 |
| Q |
171 |
gtttctgacataacaagttaagccttatcttgacaaaccatttgtgaggttagcataatactaaatttggtgatggtcgtcataagctccttactcaaaa |
270 |
Q |
| |
|
|| |||||||| |||||||||| |||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22314233 |
gtctctgacatgacaagttaaggtttatcttgacaaactatttgtgaggttagcatgatactgaatttggtgatggtcgtcgtaagctccttactcaaaa |
22314332 |
T |
 |
| Q |
271 |
tatagaatcaacaaaacaggtcattct |
297 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22314333 |
tatagaatcaacaaaacaggtcattct |
22314359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University