View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6139_high_6 (Length: 313)
Name: NF6139_high_6
Description: NF6139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6139_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 27 - 300
Target Start/End: Complemental strand, 21933736 - 21933464
Alignment:
| Q |
27 |
tttcgcacatattattatatagaacgttttcatctaagtctgaatcgttgcagttgtgtgtacgagtttcggatnnnnnnnnncattatctgaacaaaca |
126 |
Q |
| |
|
||||| ||||||| |||||| |||||| ||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||| | |
|
|
| T |
21933736 |
tttcgaacatattgttatatcgaacgtcttcgtctaagtctgaatcgttgcagttgtgtgtacgagtttcaaataaaaaaaa-cattatctgaacaaaga |
21933638 |
T |
|
| Q |
127 |
gcagccaagagaatgaggtacaaagtccgcgcgcactggagactcaaaagaaagtggcaacaggctaccccacacacaacaacatcagtactgatgaagt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21933637 |
gcagccaagagaatgaggtacaaagtccgcgcgcactggagactcaaaagaaagtggcaacaggctaccccacacacaacaacatcagtactgatgaagt |
21933538 |
T |
|
| Q |
227 |
gaccaaattgtgttatgtgtcatttaatgcaaacaaaataacttggtttgtgtgcttaaatcttaatcacattc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21933537 |
gaccaaattgtgttatgtgtcatttaatgcaaacaaaataacttggtttgtgtgcttaaatcttaatcacattc |
21933464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University