View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6139_low_12 (Length: 247)
Name: NF6139_low_12
Description: NF6139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6139_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 47626751 - 47626886
Alignment:
| Q |
19 |
cagagattacaaaacgattgattaaaccctagtagtgatgagtggtggaagaaacgagagaatgaagcaatctttcgcgccaaaacgtgggtttggggtt |
118 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626751 |
cagagattacaaaacgatt----aaaccctagtagtgatgagtggtggaagaaacgagagaatgaagcaatctttcgcgccaaaacgtgggtttggggtt |
47626846 |
T |
|
| Q |
119 |
tttatttccctaaagtgaggtccaatagtaaattgagtag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47626847 |
tttatttccctaaagtgaggtccaatagtaaattgagtag |
47626886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 221
Target Start/End: Original strand, 47627259 - 47627289
Alignment:
| Q |
191 |
atattattagatttgtttcgtatatgaagtg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
47627259 |
atattattagatttgtttcgtatatgaagtg |
47627289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University